MRO-maestro Gene View larger

MRO-maestro Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRO-maestro Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRO-maestro Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029860
Product type: DNA & cDNA
Ncbi symbol: MRO
Origin species: Human
Product name: MRO-maestro Gene
Size: 2ug
Accessions: BC029860
Gene id: 83876
Gene description: maestro
Synonyms: B29; C18orf3; protein maestro; beside the Ma29 deletion; male-specific transcription in the developing reproductive organs; maestro
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccaaagacagaggagaatcctgggccagcccctttccatccctacttcccagcccaagcagaaaaggacatcaatgatatctttcttttccaaggtctcttggaaactgagcttccagaagcgggagcctctgaagaatgtgtttttcatcttggcagaaagagctcgggaccccagtgctaaaaagcgtcacatggcaatgagaaacttgggaaccatggcctatgaagcccctgacaaggtgagaaagtataagaaaattgtcctcgacctgctggtgtatggactgtatgaccctgtgaatttggaagtcatccatgagagtatgaagactctgaccgtcgttctgggcaagatccaggggaaaggtttgggttccttcttcatagatatcgcccttcagaccaggactttattagatgatgagaacgacagtctgagatactcggcctttgttttgtttgggcaattggctgcctttgccgggaggaaatggaaaaaatttttcaccagtcaggttaagcagacacgagattccctcctgatccatttacaggacagaaatccccaggttgccaaggcttgcaaaacaacatttcaagcctgttctccatatctgaaactaaaggaggaatacagcttccagagtgaagaagatcaaaggaacactaagctctaccagcagctgagccactatcatccagagatcctgcagttcttctacgcaaataaaattctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coilin
- latexin
- latexin
- tubulin folding cofactor D

Buy MRO-maestro Gene now

Add to cart