Login to display prices
Login to display prices
APLN-apelin Gene View larger

APLN-apelin Gene

PTXBC021104

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APLN-apelin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APLN-apelin Gene

Proteogenix catalog: PTXBC021104
Ncbi symbol: APLN
Product name: APLN-apelin Gene
Size: 2ug
Accessions: BC021104
Gene id: 8862
Gene description: apelin
Synonyms: APEL; XNPEP2; AGTRL1 ligand; APJ endogenous ligand
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgccacctggtgcagcccagagggtcaaggaatgggccagggccctggcagggaggtcggaggaaattccgccgccagcggccccgcctctcccataagggacccatgcctttctgaagcaggactgaaggggcccccaagtgcccacccccggcggttatgtctcctccatagattggtctgcttctctggaggcctcacgtccattcagctctcacctcgcacctgctgtagccaccagtgggcccagctcttctcacctgcctgcttcccccagtggcgtgctcctggctgtagtttggatgattcccgttctctcacaagaatccgtccagtccatcttcctggcccctccctggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: