MGP-matrix Gla protein Gene View larger

MGP-matrix Gla protein Gene

PTXBC005272

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGP-matrix Gla protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGP-matrix Gla protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005272
Product type: DNA & cDNA
Ncbi symbol: MGP
Origin species: Human
Product name: MGP-matrix Gla protein Gene
Size: 2ug
Accessions: BC005272
Gene id: 4256
Gene description: matrix Gla protein
Synonyms: GIG36; MGLAP; NTI; matrix Gla protein; cell growth-inhibiting gene 36 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagcctgatccttcttgccatcctggccgccttagcggtagtaactttgtgttatgaatcacatgaaagcatggaatcttatgaacttaatcccttcattaacaggagaaatgcaaataccttcatatcccctcagcagagatggagagctaaagtccaagagaggatccgagaacgctctaagcctgtccacgagctcaatagggaagcctgtgatgactacagactttgcgaacgctacgccatggtttatggatacaatgctgcctataatcgctacttcaggaagcgccgaggggccaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dynactin 5 (p25)
- tetraspanin 31
- docking protein 6
- phosducin-like 3

Buy MGP-matrix Gla protein Gene now

Add to cart