SPANXE-SPANX family, member E Gene View larger

SPANXE-SPANX family, member E Gene

PTXBC005382

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPANXE-SPANX family, member E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPANXE-SPANX family, member E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005382
Product type: DNA & cDNA
Ncbi symbol: SPANXE
Origin species: Human
Product name: SPANXE-SPANX family, member E Gene
Size: 2ug
Accessions: BC005382
Gene id: 171489
Gene description: SPANX family, member E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagacctcgagtgggtactcagacccgcaacctgctccgaaaaaactaaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolactin-induced protein
- ribosomal protein L23a
- BCL2-associated X protein
- acyl-CoA thioesterase 9

Buy SPANXE-SPANX family, member E Gene now

Add to cart