hCG_1811732-hypothetical LOC151534 Gene View larger

hCG_1811732-hypothetical LOC151534 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of hCG_1811732-hypothetical LOC151534 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about hCG_1811732-hypothetical LOC151534 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009264
Product type: DNA & cDNA
Ncbi symbol: hCG_1811732
Origin species: Human
Product name: hCG_1811732-hypothetical LOC151534 Gene
Size: 2ug
Accessions: BC009264
Gene id: 151534
Gene description: hypothetical LOC151534
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggaaagaagcgtacccaggccgtctgctgtgtgcccaccccgatccccatcagtgccccacgcactcgagctcttcttcggcgtctgcagcctcttcatccgcgcggagaggcggaggtctcccggaaacagtgtccgactgtggcaccccagagcgtccaatgcgagctcaggcctttcccgcaagtctggagttttcttatccagttgaggccgccttcgctgtactcactctctgcctcccaccccatcttctgccacccgacctccatctttgatggttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - replication protein A3, 14kDa
- H2A histone family, member X
- ORM1-like 3 (S. cerevisiae)
- ORM1-like 2 (S. cerevisiae)

Buy hCG_1811732-hypothetical LOC151534 Gene now

Add to cart