NF2-neurofibromin 2 (merlin) Gene View larger

NF2-neurofibromin 2 (merlin) Gene

PTXBC007279

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NF2-neurofibromin 2 (merlin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NF2-neurofibromin 2 (merlin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007279
Product type: DNA & cDNA
Ncbi symbol: NF2
Origin species: Human
Product name: NF2-neurofibromin 2 (merlin) Gene
Size: 2ug
Accessions: BC007279
Gene id: 4771
Gene description: neurofibromin 2 (merlin)
Synonyms: ACN; BANF; SCH; merlin; moesin-ezrin-radixin like; moesin-ezrin-radixin-like protein; moesin-ezrin-radizin-like protein; neurofibromin 2 (bilateral acoustic neuroma); schwannomerlin; schwannomin; neurofibromin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtttcattacgagcccttctgctggctctcaggcagaagccccacagcaccgggaccattcatgaggtcactgcccagctcatgatgtccgtgaggctgtccttttggccagtagccgtgtgcagctgtgtggcacagatggcttcgttcatcctgatcaaggccccacctcagccacagcagtccccccaacctgtgttgtccaccctattattcatgtacctgccaggccctgctagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LYR motif containing 2
- B-cell CLL/lymphoma 7C
- Sp2 transcription factor
- SH2 domain protein 2A

Buy NF2-neurofibromin 2 (merlin) Gene now

Add to cart