Login to display prices
Login to display prices
LYRM2-LYR motif containing 2 Gene View larger

LYRM2-LYR motif containing 2 Gene

PTXBC009782

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYRM2-LYR motif containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LYRM2-LYR motif containing 2 Gene

Proteogenix catalog: PTXBC009782
Ncbi symbol: LYRM2
Product name: LYRM2-LYR motif containing 2 Gene
Size: 2ug
Accessions: BC009782
Gene id: 57226
Gene description: LYR motif containing 2
Synonyms: DJ122O8.2; LYR motif-containing protein 2; LYR motif containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcttcccgcttacccccagcgacgctaacgttaaagcagttcgtaagaaggcaacaagttcttctcctctacagaaggattttgcaaacaattcggcaagttccaaatgattctgatcgcaaatacctgaaagattgggcaagagaagaattcagaagaaacaaaagtgccaccgaagaggatacaatccggatgatgattactcaaggcaatatgcagctcaaggagttagaaaaaacacttgctttagcaaaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: