LYRM2-LYR motif containing 2 Gene View larger

LYRM2-LYR motif containing 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYRM2-LYR motif containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LYRM2-LYR motif containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009782
Product type: DNA & cDNA
Ncbi symbol: LYRM2
Origin species: Human
Product name: LYRM2-LYR motif containing 2 Gene
Size: 2ug
Accessions: BC009782
Gene id: 57226
Gene description: LYR motif containing 2
Synonyms: DJ122O8.2; LYR motif-containing protein 2; LYR motif containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcttcccgcttacccccagcgacgctaacgttaaagcagttcgtaagaaggcaacaagttcttctcctctacagaaggattttgcaaacaattcggcaagttccaaatgattctgatcgcaaatacctgaaagattgggcaagagaagaattcagaagaaacaaaagtgccaccgaagaggatacaatccggatgatgattactcaaggcaatatgcagctcaaggagttagaaaaaacacttgctttagcaaaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - B-cell CLL/lymphoma 7C
- Sp2 transcription factor
- SH2 domain protein 2A
- protein kinase C, zeta

Buy LYRM2-LYR motif containing 2 Gene now

Add to cart