SH2D2A-SH2 domain protein 2A Gene View larger

SH2D2A-SH2 domain protein 2A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH2D2A-SH2 domain protein 2A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH2D2A-SH2 domain protein 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012107
Product type: DNA & cDNA
Ncbi symbol: SH2D2A
Origin species: Human
Product name: SH2D2A-SH2 domain protein 2A Gene
Size: 2ug
Accessions: BC012107
Gene id: 9047
Gene description: SH2 domain protein 2A
Synonyms: F2771; SCAP; VRAP; SH2 domain-containing protein 2A; SH2 domain protein 2A; T cell specific adapter protein TSAd; T lymphocyte specific adaptor protein; VEGF receptor-associated protein; SH2 domain containing 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttccccctggcccagatatgtccccaagggagtcacgaagcccccatcccaaccttcagcaccttccagatcacagacatgacccgcaggagctgccagaacctgggctacactgcggcatctccccaggccccggaggctgcctccagcacagggaatgctgagagggcagaggaggtgcctggagaaggaagcctgttcctgcaggccgagacccgggcttggttccagaagacccaggcccactggctcctgcagcacggggcagcccctgcctggttccatggcttcatcacccggagggaggcagagaggctgctggagcccaagcctcaggggtgctacttggtgcggttcagcgagagcgcggtgaccttcgtgctgacttacaggagccggacttgctgccgccacttcctgctggcccagctcagggacgggcgccacgtggtgctgggcgaggacagcgcccacgcgcggctgcaggacctgctgctgcactacaccgcgcacccgctcagcccctacggggagacgctcaccgagcccctcgcccgacagactcctgagcctgcaggactttccctgaggaccgaagaatcaaactttggaagcaaaagccaggacccaaacccccagtacagcccaatcatcaaacaggggcaagccccagtcccgatgcagaaagagggggccggggagaaggagccctcccagctgctcaggcccaagcctcccatccccgccaaacctcagctgcccccagaagtctacacaatccctgttccacgacaccgcccggccccacgccccaagccctccaatcctatctacaatgagcctgatgaacccatagctttctatgccatgggccggggcagccctggggaagcccccagcaacatctatgtggaagtggaagatgagggcctacccgccacccttgggcaccctgtcctacggaagagctggtccaggcctgtcccaggaggccagaatacaggtggctcccagctgcattctgagaactctgtgattgggcaaggccctcccctgccccaccagcccccacccgcctggagacacaccctcccccacaatctttctagacaggtgcttcaggacagaggacaggcatggcttccccttgggcctcctcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein kinase C, zeta
- arginyl-tRNA synthetase
- PR domain containing 4
- zinc finger homeobox 3

Buy SH2D2A-SH2 domain protein 2A Gene now

Add to cart