SRP9-signal recognition particle 9kDa Gene View larger

SRP9-signal recognition particle 9kDa Gene

PTXBC021995

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SRP9-signal recognition particle 9kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SRP9-signal recognition particle 9kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021995
Product type: DNA & cDNA
Ncbi symbol: SRP9
Origin species: Human
Product name: SRP9-signal recognition particle 9kDa Gene
Size: 2ug
Accessions: BC021995
Gene id: 6726
Gene description: signal recognition particle 9kDa
Synonyms: ALURBP; signal recognition particle 9 kDa protein; signal recognition particle 9kD; signal recognition particle 9kDa; signal recognition particle 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcagtaccagacctgggaggagttcagccgcgctgccgagaagctttacctcgctgaccctatgaaggcacgtgtggttctcaaatataggcattctgatgggaacttgtgtgttaaagtaacagatgatttagttagacagtgtcttgctctattgctcaggctgcagtgcagtggcatgatcatggctcactgcatcctcgacctcctgggctcaagcggtcctcttgcttcagcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 108
- zinc ribbon domain containing 1
- Huntingtin interacting protein K
- TSC22 domain family, member 1

Buy SRP9-signal recognition particle 9kDa Gene now

Add to cart