GPR108-G protein-coupled receptor 108 Gene View larger

GPR108-G protein-coupled receptor 108 Gene

PTXBC007862

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR108-G protein-coupled receptor 108 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR108-G protein-coupled receptor 108 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007862
Product type: DNA & cDNA
Ncbi symbol: GPR108
Origin species: Human
Product name: GPR108-G protein-coupled receptor 108 Gene
Size: 2ug
Accessions: BC007862
Gene id: 56927
Gene description: G protein-coupled receptor 108
Synonyms: protein GPR108; LUSTR2; lung seven transmembrane receptor 2; G protein-coupled receptor 108
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcatctgctacgtctacttcacccgcatcatcgccatcctgctgcaggtggctgtgccctttcagtggcagtggctgtaccagctcttggtggagggctccaccctggccttcttcgtgctcacgggctacaagttccagcccacagggaacaacccgtacctgcagctgccccaggaggacgaggaggatgttcagatggagcaagtaatgacggactctgggttccgggaaggcctctccaaagtcaacaaaacagccagcgggcgggaactgttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc ribbon domain containing 1
- Huntingtin interacting protein K
- TSC22 domain family, member 1
- Wilms tumor 1 associated protein

Buy GPR108-G protein-coupled receptor 108 Gene now

Add to cart