Login to display prices
Login to display prices
BCHE-butyrylcholinesterase Gene View larger

BCHE-butyrylcholinesterase Gene

PTXBC008396

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCHE-butyrylcholinesterase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BCHE-butyrylcholinesterase Gene

Proteogenix catalog: PTXBC008396
Ncbi symbol: BCHE
Product name: BCHE-butyrylcholinesterase Gene
Size: 2ug
Accessions: BC008396
Gene id: 590
Gene description: butyrylcholinesterase
Synonyms: CHE1; CHE2; cholinesterase; acylcholine acylhydrolase; butyrylcholine esterase; choline esterase II; cholinesterase (serum) 2; cholinesterase 1; pseudocholinesterase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaaactacgtgctcaacaatgtcgattctggacatcattttttccaaaagtcttggaaatgacaggaaatattgatgaagcagaatgggagtggaaagcaggattccatcgctggaacaattacatgatggactggaaaaatcaatttaacgattacactagcaagaaagaaagttgtgtgggtctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: