PLGLB2-plasminogen-like B2 Gene View larger

PLGLB2-plasminogen-like B2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLGLB2-plasminogen-like B2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLGLB2-plasminogen-like B2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005379
Product type: DNA & cDNA
Ncbi symbol: PLGLB2
Origin species: Human
Product name: PLGLB2-plasminogen-like B2 Gene
Size: 2ug
Accessions: BC005379
Gene id: 5342
Gene description: plasminogen-like B2
Synonyms: PLGP1; plasminogen-like protein B; plasminogen pseudogene 1; plasminogen-related protein B; type B plasminogen related; plasminogen-like B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacataaggaagtggttcttctacttcttttatttctgaaatcaggtcaaggagagcccctggatgactatgtgaatacccaggggccttcactgttcagtgtcactaagaagcagctgggggcaggaagcagagaagaatgtgcagcaaaatgtgaagaggacaaagaattcacctgcagggcattccaatatcacagtaaagagcaacaatgtgtgataatggctgaaaacaggaagtcctccataatcattaggatgagagatgcagttttatttgaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cystatin A (stefin A)
- cytochrome c, somatic
- ring finger protein 5
- nucleoredoxin-like 1

Buy PLGLB2-plasminogen-like B2 Gene now

Add to cart