CSTA-cystatin A (stefin A) Gene View larger

CSTA-cystatin A (stefin A) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSTA-cystatin A (stefin A) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSTA-cystatin A (stefin A) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010379
Product type: DNA & cDNA
Ncbi symbol: CSTA
Origin species: Human
Product name: CSTA-cystatin A (stefin A) Gene
Size: 2ug
Accessions: BC010379
Gene id: 1475
Gene description: cystatin A (stefin A)
Synonyms: AREI; PSS4; STF1; STFA; cystatin-A; cystatin A (stefin A); cystatin AS; cystatin A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatacctggaggcttatctgaggccaaacccgccactccagaaatccaggagattgttgataaggttaaaccacagcttgaagaaaaaacaaatgagacttatggaaaattggaagctgtgcagtataaaactcaagttgttgctggaacaaattactacattaaggtacgagcaggtgataataaatatatgcacttgaaagtattcaaaagtcttcccggacaaaatgaggacttggtacttactggataccaggttgacaaaaacaaggatgacgagctgacgggcttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c, somatic
- ring finger protein 5
- nucleoredoxin-like 1
- exosome component 5

Buy CSTA-cystatin A (stefin A) Gene now

Add to cart