Login to display prices
Login to display prices
EXOSC5-exosome component 5 Gene View larger

EXOSC5-exosome component 5 Gene

PTXBC007742

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOSC5-exosome component 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOSC5-exosome component 5 Gene

Proteogenix catalog: PTXBC007742
Ncbi symbol: EXOSC5
Product name: EXOSC5-exosome component 5 Gene
Size: 2ug
Accessions: BC007742
Gene id: 56915
Gene description: exosome component 5
Synonyms: RRP41B; RRP46; Rrp46p; hRrp46p; p12B; exosome complex component RRP46; chronic myelogenous leukemia tumor antigen 28; exosome complex exonuclease RRP46; exosome component Rrp46; ribosomal RNA-processing protein 46; exosome component 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggagatgcatactgacgccaaaatccgtgctgaaaatggaacagggtccagccctcggggtcctggctgcagcctccggcactttgcctgcgaacagaacctgctgtcgcggccagatggctctgcttccttcctgcaaggtgacacctctgtcctggcgggtgtgtacgggccggccgaggtgaaggtcagcaaagagattttcaacaaggccacactcgaagtgatcctgaggccgaagattgggctgcctggtgttgcagagaagagccgggagcggctgatcaggaacacgtgcgaggcggtggtgctgggcacgttgcacccccgcacctccatcaccgtggtgctgcaggttgtcagcgatgccggctctctcctggcctgttgtctgaatgccgcctgcatggcattggtggatgcaggtgtgcccatgcgggctctcttctgtggggtcgcctgcgccctggactctgatgggaccctcgtgctggatcctacatccaagcaagaaaaggaggcccgggcagtcctgacctttgccctggacagcgtggaacggaagctgctgatgtccagcaccaaggggctctactcagacactgagctccagcagtgcctggctgcggcccaggccgcttcgcaacacgtcttccgtttctaccgggaatcgctgcagaggcgttactccaagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: