PRM1-protamine 1 Gene View larger

PRM1-protamine 1 Gene

PTXBC003673

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRM1-protamine 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRM1-protamine 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003673
Product type: DNA & cDNA
Ncbi symbol: PRM1
Origin species: Human
Product name: PRM1-protamine 1 Gene
Size: 2ug
Accessions: BC003673
Gene id: 5619
Gene description: protamine 1
Synonyms: CT94.1; sperm protamine P1; cancer/testis antigen family 94, member 1; cysteine-rich protamine; testicular tissue protein Li 91; testis specific protamine 1; protamine 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaaagaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgccgccccaggtacagaccgagatgtagaagacactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protamine 2
- cystatin SN
- betacellulin
- keratin 81

Buy PRM1-protamine 1 Gene now

Add to cart