Login to display prices
Login to display prices
PRM2-protamine 2 Gene View larger

PRM2-protamine 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRM2-protamine 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRM2-protamine 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005303
Product type: DNA & cDNA
Ncbi symbol: PRM2
Origin species: Human
Product name: PRM2-protamine 2 Gene
Size: 2ug
Accessions: BC005303
Gene id: 5620
Gene description: protamine 2
Synonyms: CT94.2; protamine-2; cancer/testis antigen family 94, member 2; sperm histone P2; sperm protamine P2; testicular secretory protein Li 40; protamine 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccgataccgcgtgaggagcctgagcgaacgctcgcacgaggtgtacaggcagcagttgcatgggcaagagcaaggacaccacggccaagaggagcaagggctgagcccggagcacgtcgaggtctacgagaggacccatggccagtctcactataggcgcagacactgctctcgaaggaggctgcaccggatccacaggcggcagcatcgctcctgcagaaggcgcaaaagacgctcctgcaggcaccggaggaggcatcgcagaggctgcagaaccaggaagagaacatgcagaaggcactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cystatin SN
- betacellulin
- keratin 81
- oncostatin M