MGC16075-hypothetical protein MGC16075 Gene View larger

MGC16075-hypothetical protein MGC16075 Gene

PTXBC007354

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC16075-hypothetical protein MGC16075 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC16075-hypothetical protein MGC16075 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007354
Product type: DNA & cDNA
Ncbi symbol: MGC16075
Origin species: Human
Product name: MGC16075-hypothetical protein MGC16075 Gene
Size: 2ug
Accessions: BC007354
Gene id: 84847
Gene description: hypothetical protein MGC16075
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagagaccctatgactcccgcacatgcattgggtcaagtcacagtagaggaccactgagctgggcaccatgtggacctatagcaggcagcaggcaagccctctcctttgaggttcctccctgcaactacgaccccgaaaaatggatccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC16025
- hypothetical protein MGC15634
- hypothetical protein MGC16121
- S100 calcium binding protein A1

Buy MGC16075-hypothetical protein MGC16075 Gene now

Add to cart