PCGF5-polycomb group ring finger 5 Gene View larger

PCGF5-polycomb group ring finger 5 Gene

PTXBC007377

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCGF5-polycomb group ring finger 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCGF5-polycomb group ring finger 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007377
Product type: DNA & cDNA
Ncbi symbol: PCGF5
Origin species: Human
Product name: PCGF5-polycomb group ring finger 5 Gene
Size: 2ug
Accessions: BC007377
Gene id: 84333
Gene description: polycomb group ring finger 5
Synonyms: RNF159; polycomb group RING finger protein 5; RING finger protein 159; ring finger protein (C3HC4 type) 159; polycomb group ring finger 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctacccaaaggaaacacttggtgaaagattttaatccttacattacctgctatatctgtaaagggtatctgatcaagccaacaacagtgacggaatgcctccatacatctgcagaatcctactggatgtccacttggatgtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histamine N-methyltransferase
- hypothetical LOC151534
- replication protein A3, 14kDa
- H2A histone family, member X

Buy PCGF5-polycomb group ring finger 5 Gene now

Add to cart