Login to display prices
Login to display prices
NLN-neurolysin (metallopeptidase M3 family) Gene View larger

NLN-neurolysin (metallopeptidase M3 family) Gene

PTXBC001644

New product

Data sheet of NLN-neurolysin (metallopeptidase M3 family) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NLN-neurolysin (metallopeptidase M3 family) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001644
Ncbi symbol: NLN
Product name: NLN-neurolysin (metallopeptidase M3 family) Gene
Size: 2ug
Accessions: BC001644
Gene id: 57486
Gene description: neurolysin (metallopeptidase M3 family)
Synonyms: AGTBP; EP24.16; MEP; MOP; neurolysin, mitochondrial; angiotensin binding protein; endopeptidase 24.16; microsomal endopeptidase; mitochondrial oligopeptidase M; neurolysin (metallopeptidase M3 family); neurotensin endopeptidase; neurolysin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcgcccggtgccttttggctgtgcgaagcctccgcagagttggtggttccaggattttactcagaatgacgttaggaagagaagtgatgtctcctcttcaggcaatgtcttcctatactgtggctggcagaaatgttttaagatgggatctttcaccagagcaaattaaaacaagaactgaggagctcattgtgcagaccaaacaggtgtacgatgctgttggaatgctcggtattgaggaagtaacttacgagaactgtctgcaggcactggcagatgtagaagtaaagtatatagtggaaaggaccatgctagactttccccagcatgtatcctctgacaaagaagtacgagcagcaagtacagaagcagacaaaagactttctcgttttgatattgagatgagcatgagaggagatatatttgagagaattgttcatttacaggaaacctgtgatctggggaagataaaacctgaggccagacgatacttggaaaagtcaattaaaatggggaaaagaaatgggctccatcttcctgaacaagtacagaatgaaatcaaatcaatgaagaaaagaatgagtgagctatgtattgattttaacaaaaacctcaatgaggatgataccttccttgtattttccaaggctgaacttggtgctcttcctcatgatttcattgacagtttagaaaagacagatgatgacaagtataaaattaccttaaaatatccacactatttccctgtcatgaagaaatgttgtatccctgaaaccagaagaaggatggaaatggcttttaatacaaggtgcaaagaggaaaacaccataattttgcagcagctactcccactgcgaaccaaggtggccaaactactcggttatagcacacatgctgacttcgtccttgaaatgaacactgcaaagagcacaagccgcgtaacagcctttctagatgatttaagccagaagttaaaacccttgggtgaagcagaacgagagtttattttgaatttgaagaaaaaggaatgcaaagacaggggttttgaatatgatgggaaaatcaatgcctgggatctatattactacatgactcagacagaggaactcaagtattccatagaccaagagttcctcaaggaatacttcccaattgaggtggtcactgaaggcttgctgaacacctaccaggagttgttgggactttcatttgaacaaatgacagatgctcatgtttggaacaagagtgttacactttatactgtgaaggataaagctacaggagaagtattgggacagttctatttggacctctatccaagggaaggaaaatacaatcatgcggcctgcttcggtctccagcctggctgccttctgcctgatggaagccggatgatggcagtggctgccctcgtggtgaacttctcacagccagtggcaggtcgtccctctctcctgagacacgacgaggtgaggacttactttcatgagtttggtcacgtgatgcatcagatttgtgcacaggtgagttttttttttcccccagtaaacctgccaattagtttttttagaaaacttcttgactgctgtcaggtttctgctcctaacaggttttttcagaagctgaatgtgttcaagaattttataggccttctgcaaaaccaaaattttccttatcctgtcctctttcacaacatatttttacttggaggttcatctaccagtgaaagatgtttgttgaataacagcctatggaaaaagaataagactatctgtaaggaaaggttacaaatactttgctttttccttttaatcctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: