Login to display prices
Login to display prices
GMCL1L-germ cell-less homolog 1 (Drosophila)-like Gene View larger

GMCL1L-germ cell-less homolog 1 (Drosophila)-like Gene

PTXBC033886

New product

Data sheet of GMCL1L-germ cell-less homolog 1 (Drosophila)-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GMCL1L-germ cell-less homolog 1 (Drosophila)-like Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC033886
Ncbi symbol: GMCL1L
Product name: GMCL1L-germ cell-less homolog 1 (Drosophila)-like Gene
Size: 2ug
Accessions: BC033886
Gene id: 64396
Gene description: germ cell-less homolog 1 (Drosophila)-like
Synonyms: Gmcl1l; 1700017G21Rik; Gclh; Gmcl2; germ cell-less protein-like 1-like; germ cell-less homolog 1-like; germ cell-less protein-like 2; germ cell-less, spermatogenesis associated-like; BTB domain containing 35, family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatcgtcgagcagccgggtgctgggccagccgaggcgagcccttgcccagcaggaacagggtgccagggccaggggctcggcccggaggccggacactggagacgatgcggcgagctacggcttctgttactgcccgggcagtcacaagcgcaagcggagcagcggggcctgccgctactgtgacccggactcgcacagggaggagcatgaggaggagggggacaagcagcagccgctcctcaacacccctgcaaggaaaaaattaaggagtacatccaaatatatttatcaaacattatttttgaatggtgaaaacagtgacattaagatttgtgctctaggagaagaatggcgattacacaaaatatatttatgtcaatctggctacttttctagtatgttcagtggttcttggaaagaatccagcatgaatattattgaactggagattcctgaccagaacattgatgtagacgcactgcaggttgcgtttggttcactgtatcgagatgatgtcttgataaaacccagtcgagttgttgccattttggcagcagcttgtatgctgcagctggatggtttaatacagcagtgtggtgagacaatgaaggaaacaattaatgtgaaaactgtatgcggttattacacatcagtagagatctatggattagattctgtaaagaaaaagtgccttgaatggcttctaaacaatttgatgactcaccagaatgttaaactttttaaagaactcggtataaatgtcatgaaacagctcattggttcctctaacttatttgtgatgcaagtggagatggatgtatacaccactctaaaaaagtggatgttccttcaacttgtgccttcttggaatggatctttaaaacagcttttgacagaaacagatgtctggttttctaaacagagaaaagattttgaaggtatggcctttcttgaaactgaaccaggaaaaccatttgtgtcagtattcagacatttaaggttacaatatattatcagtgacctagcttctgcaagaattattgaacaagatggtatagtaccttcagaatggctgtcttctgtgtataaacagcagtggtttgctatgctgcgggcagaacaagaccatgaggtagggcctcaagaaatcaataaagaagacctagagggaagtagcatgaggtgtggtagaaagcttgccaaagatggtgaatactactggtgttggacgggttttaacttcggctttgacctacttgtaatttacaccaatggatacatcattttcaaacgcaatacactgaatcagccatgcagcgggtctgtcagtttacggcctcgaaggagcatagcatttagattacgcttggcttcttttgatagtagtggaaaactagtatgtagtagaacaactggctatcaaatacttatacttaaaaaggatcaggaacaagtggtgatgaacttggacagcaggtttctgaccttccctttatatatctgctgtaacttcttgtatatatcaccagaaaaaggaattgaaaataatcgccacccagaagatccagaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: