Login to display prices
Login to display prices
TM9SF3-transmembrane 9 superfamily member 3 Gene View larger

TM9SF3-transmembrane 9 superfamily member 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM9SF3-transmembrane 9 superfamily member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TM9SF3-transmembrane 9 superfamily member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020959
Product type: DNA & cDNA
Ncbi symbol: TM9SF3
Origin species: Human
Product name: TM9SF3-transmembrane 9 superfamily member 3 Gene
Size: 2ug
Accessions: BC020959
Gene id: 56889
Gene description: transmembrane 9 superfamily member 3
Synonyms: EP70-P-iso; SMBP; transmembrane 9 superfamily member 3; SM-11044 binding protein; dinucleotide oxidase disulfide thiol exchanger 3 superfamily member 3; endomembrane protein emp70 precursor isolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacatagatgatttaccaatatggggtattgttggtgaggctgatgaaaatggagaagattactatctttggacctataaaaaacttgaaataggttttaatggaaatcgaattgttgatgttaatctaactagtgaaggaaaggtgaaactggttccaaatactaaaatccagatgtcatattcagtaaaatggaaaaagtcagatgtgaaatttgaagatcgatttgacaaatatcttgatccgtccttttttcaacatcggattcattggttttcaattttcaactccttcatgatggtgatcttcttggtgggcttagtttcaatgattttaatgagaacattaagaaaagattatgctcggtacagtaaagaggaagaaatggatgatatggatagagacctaggagatgaatatggatggaaacaggtgcatggagatgtatttagaccatcaagtcacccactgatattttcctctctgattggttctggatgtcagatatttgctgtgtctctcatcgttattattgttgcaatgatagaagatttatatactgagaggggatcaatgctcagtacagccatatttgtctatgctgctacgtctccagtgaatggttattttggaggaagtctgtatgctagacaaggaggaaggagatggataaagcagatgtttattggggcattccttatcccagctatggtgtgtggcactgccttcttcatcaatttcatagccatttattaccatgcttcaagagccattccttttggaacaatggtggccgtttgttgcatctgtttttttgttattcttcctctaaatcttgttggtacaatacttggccgaaatctgtcaggtcagcccaactttccttgtcgtgtcaatgctgtgcctcgtcctataccggagaaaaaatggttcatggagcctgcggttattgtttgcctgggtggaattttaccttttggttcaatctttattgaaatgtatttcatcttcacgtctttctgggcatataagatctattatgtctatggcttcatgatgctggtgctggttatcctgtgcattgtgactgtctgtgtgactattgtgtgcacatattttctactaaatgcagaagattacaggtggcaatggacaagttttctctctgctgcatcaactgcaatctatgtttacatgtattccttttactactattttttcaaaacaaagatgtatggcttatttcaaacatcattttactttggatatatggcggtatttagcacagccttggggataatgtgtggagcgattggttacatgggaacaagtgcctttgtccgaaaaatctatactaatgtgaaaattgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thyroid hormone receptor interactor 6
- thyroid hormone receptor interactor 6
- immunoglobulin heavy constant alpha 1
- solute carrier family 35, member F5