IGHA1-immunoglobulin heavy constant alpha 1 Gene View larger

IGHA1-immunoglobulin heavy constant alpha 1 Gene

PTXBC005951

New product

Data sheet of IGHA1-immunoglobulin heavy constant alpha 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGHA1-immunoglobulin heavy constant alpha 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC005951
Product type: DNA & cDNA
Ncbi symbol: IGHA1
Origin species: Human
Product name: IGHA1-immunoglobulin heavy constant alpha 1 Gene
Size: 2ug
Accessions: BC005951
Gene id: 3493
Gene description: immunoglobulin heavy constant alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggacctggagcatccttttcttggtggcagcagcaacaggtgcccagtcccaggttcacctggtgcagtctggggctgaggtgatgtcgcctggggcctcagtgagggtctcctgcaagacctctggttacgcctttcacacctatagtattatctgggtgcggcaggcccctggacaagggcttgagtggatgggatggatcagcccttccagtgataacacaaggtttgcaaagaagttccagggcagagtcaccctgaccactgacacatccacgagcacagtctacatggagctgcggagcctgagatctgacgacacggccgtgtattactgtgcgagacgatattgtagttattccagctgccagaatgactactattactactacatggacgtctggggcaaagggaccacggtcaccgtctcctcagcatccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctggtccagggcttcttcccccaggagccactcagtgtgacctggagcgaaagcggacagggcgtgaccgccagaaacttcccacccagccaggatgcctccggggacctgtacaccacgagcagccagctgaccctgccggccacacagtgcctagccggcaagtccgtgacatgccacgtgaagcactacacgaatcccagccaggatgtgactgtgccctgcccagttccctcaactccacctaccccatctccctcaactccacctaccccatctccctcatgctgccacccccgactgtcactgcaccgaccggccctcgaggacctgctcttaggttcagaagcgaacctcacgtgcacactgaccggcctgagagatgcctcaggtgtcaccttcacctggacgccctcaagtgggaagagcgctgttcaaggaccacctgaccgtgacctctgtggctgctacagcgtgtccagtgtcctgtcgggctgtgccgagccatggaaccatgggaagaccttcacttgcactgctgcctaccccgagtccaagaccccgctaaccgccaccctctcaaaatccggaaacacattccggcccgaggtccacctgctgccgccgccgtcggaggagctggccctgaacgagctggtgacgctgacgtgcctggcacgtggcttcagccccaaggatgtgctggttcgctggctgcaggggtcacaggagctgccccgcgagaagtacctgacttgggcatcccggcaggagcccagccagggcaccaccaccttcgctgtgaccagcatactgcgcgtggcagccgaggactggaagaagggggacaccttctcctgcatggtgggccacgaggccctgccgctggccttcacacaggagaccatcgaccgcttggcgggtaaacccacccatgtcaatgtgtctgttgtcatggcggaggtggacggcacctgctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35, member F5
- Fas-activated serine/threonine kinase
- neurolysin (metallopeptidase M3 family)
- anaphase promoting complex subunit 5

Buy IGHA1-immunoglobulin heavy constant alpha 1 Gene now

Add to cart