Login to display prices
Login to display prices
TRIP6-thyroid hormone receptor interactor 6 Gene View larger

TRIP6-thyroid hormone receptor interactor 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIP6-thyroid hormone receptor interactor 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRIP6-thyroid hormone receptor interactor 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004999
Product type: DNA & cDNA
Ncbi symbol: TRIP6
Origin species: Human
Product name: TRIP6-thyroid hormone receptor interactor 6 Gene
Size: 2ug
Accessions: BC004999
Gene id: 7205
Gene description: thyroid hormone receptor interactor 6
Synonyms: OIP-1; OIP1; TRIP-6; TRIP6i2; ZRP-1; thyroid receptor-interacting protein 6; OPA-interacting protein 1; TR-interacting protein 6; thyroid hormone receptor interacting protein 6; zyxin related protein 1; thyroid hormone receptor interactor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccagggggaccggaggatcgggggccggcgtgggtggggtcccatggagtactccagcacacgcaggggctccctgcagacagggggggccttcgccctggaagcctggacgccgagatagacttgctgagcagcacgctggccgagctgaatgggggtcggggtcatgcgtcacggcgaccagaccgacaggcatatgagcccccgccacctcctgcctaccgcacgggctccctgaagccaaatccagcctcgccgctcccagcgtctccctatgggggccccactccagcctcttacactaccgccagcaccccggctggcccagccttccccgtgcaagtgaaggtggcacagccagtgaggggctgcggcccacccaggcggggagcctctcaggcctctgggcccctcccgggcccccactttcctctcccaggccgaggtgaagtctgggggcctggctataggagccagagagagccagggccaggggccaaagaggaagctgctggggtctctggccctgcaggaagaggaagaggaggcgagcacgggccccaggtgcccctgagccagcctccagaggatgagctggataggctgacgaagaagctggttcacgacatgaaccacccgcccagcggggagtactttggccagtgtggtggctgcggagaagatgtggttggggatggggctggggttgtggcccttgatcgcgtctttcacgtgggctgctttgtatgttctacatgccgggcccagcttcgcggccagcatttctacgccgtggagaggagggcatattgcgagggctgctacgtggccaccctggagaaatgtgccacgtgctcccagcccatcctggaccggatcctgcgggctatggggaaggcctaccaccctggctgcttcacctgcgtggtgtgtcaccgcggcctcgacggcatccccttcacagtggatgctacgagccagatccactgcattgaggactttcacaggaagtttgccccaagatgctcagtgtgcggtggggccataatgcctgagccaggtcaggaggagactgtgagaattgttgctctggatcgaagttttcacattggctgttacaagtgcgaggagtgtgggctgctgctctcctctgagggcgagtgtcagggctgctacccgctggatgggcacatcttgtgcaaggcctgcagcgcctggcgcatccaggagctctcagccaccgtcaccactgactgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thyroid hormone receptor interactor 6
- immunoglobulin heavy constant alpha 1
- solute carrier family 35, member F5
- Fas-activated serine/threonine kinase