Login to display prices
Login to display prices
PDK3-pyruvate dehydrogenase kinase, isozyme 3 Gene View larger

PDK3-pyruvate dehydrogenase kinase, isozyme 3 Gene

PTXBC015948

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDK3-pyruvate dehydrogenase kinase, isozyme 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDK3-pyruvate dehydrogenase kinase, isozyme 3 Gene

Proteogenix catalog: PTXBC015948
Ncbi symbol: PDK3
Product name: PDK3-pyruvate dehydrogenase kinase, isozyme 3 Gene
Size: 2ug
Accessions: BC015948
Gene id: 5165
Gene description: pyruvate dehydrogenase kinase, isozyme 3
Synonyms: CMTX6; GS1-358P8.4; pyruvate dehydrogenase kinase, isozyme 3; [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 3, mitochondrial; pyruvate dehydrogenase kinase, isoenzyme 3; pyruvate dehydrogenase, lipoamide, kinase isozyme 3, mitochondrial; pyruvate dehydrogenase kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggctaacacaatgagagaagttaatcttctgccggataatttacttaaccgcccttcagtgggattggttcagagttggtatatgcagagttttcttgaacttttagaatatgaaaataagagccctgaggatccacaggtcttggataactttctacaagttctgattaaagtcagaaatagacacaatgatgtggttcctacaatggcacaaggagtgattgaatacaaggagaagtttgggtttgatcctttcattagcactaacatccaatattttctggatcggttttataccaaccgcatctctttccgcatgcttattaatcagcacacacttctgtttgggggtgacactaatcctgttcatcctaaacacataggaagtatcgatcccacctgtaacgtggcggatgtggtgaaagatgcatatgaaacagccaagatgctgtgtgaacagtattacctggtagctccagagctggaagttgaagaattcaatgccaaagcgccagacaaacctattcaggtggtttatgtgccctcacatctgtttcatatgctatttgagttgttcaagaactcaatgagagcgacagttgaactctatgaagacagaaaagagggctaccctgctgttaaaaccctcgttactttgggtaaagaagacttatccattaagatcagtgacctaggtggtggtgtcccacttcgaaaaatagatcgtctttttaactacatgtattctactgctcctagacccagcctggagcctaccagagctgcccctttggctggatttggttatggtttgccaatttcccgtctgtatgctagatattttcaaggagatctgaaactgtattccatggaaggagtgggtactgatgctgtcatttatttgaaggctctttcaagtgagtcatttgagagacttccagtttttaataagtccgcatggcgccattacaagaccacgcctgaagccgatgattggagcaatcccagcagtgaacccagggatgcttcaaaatacaaagcaaaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: