Login to display prices
Login to display prices
CTH-cystathionase (cystathionine gamma-lyase) Gene View larger

CTH-cystathionase (cystathionine gamma-lyase) Gene

PTXBC015807

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTH-cystathionase (cystathionine gamma-lyase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTH-cystathionase (cystathionine gamma-lyase) Gene

Proteogenix catalog: PTXBC015807
Ncbi symbol: CTH
Product name: CTH-cystathionase (cystathionine gamma-lyase) Gene
Size: 2ug
Accessions: BC015807
Gene id: 1491
Gene description: cystathionase (cystathionine gamma-lyase)
Synonyms: cystathionine gamma-lyase; cystathionase (cystathionine gamma-lyase); cysteine desulfhydrase; cysteine-protein sulfhydrase; gamma-cystathionase; homoserine deaminase; homoserine dehydratase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggaaaaagacgcctcctcacaaggtttcctgccacacttccaacatttcgccacgcaggcgatccatgtgggccaggatccagagcaatggacctccagggctgtagtgccccccatctcactgtccaccacgttcaagcaaggggcgcctggccagcactcgggttttgaatatagccgttctggaaatcccactaggaattgccttgaaaaagcagtggcagcactggatggggctaagtactgtttggcctttgcttcaggtttagcagccactgtaactattacccatcttttaaaagcaggagaccaaattatttgtatggatgatgtgtatggaggtacaaacaggtacttcaggcaagtggcatctgaatttggattaaagatttcttttgttgattgttccaaaatcaaattactagaggcagcaattacaccagaaaccaagcttgtttggatcgaaacccccacaaaccccacccagaaggtgattgacattgaaggctgtgcacatattgtccataagcatggagacattattttggtcgtggataacacttttatgtcaccatatttccagcgccctttggctctgggagctgatatttctatgtattctgcaacaaaatacatgaatggccacagtgatgttgtaatgggcctggtgtctgttaattgtgaaagccttcataatagacttcgtttcttgcaaaactctcttggagcagttccatctcctattgattgttacctctgcaatcgaggtctgaagactctacatgtccgaatggaaaagcatttcaaaaacggaatggcagttgcccagttcctggaatctaatccttgggtagaaaaggttatttatcctgggctgccctctcatccacagcatgagttggtgaagcgtcagtgtacaggttgtacagggatggtcaccttttatattaagggcactcttcagcatgctgagattttcctcaagaacctaaagctatttactctggccgagagcttgggaggattcgaaagccttgctgagcttccggcaatcatgactcatgcatcagttcttaagaatgacagagatgtccttggaattagtgacacactgattcgactttctgtgggcttagaggatgaggaagacctactggaagatctagatcaagctttgaaggcagcacaccctccaagtggaagtcacagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: