CTH-cystathionase (cystathionine gamma-lyase) Gene View larger

CTH-cystathionase (cystathionine gamma-lyase) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTH-cystathionase (cystathionine gamma-lyase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CTH-cystathionase (cystathionine gamma-lyase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015807
Product type: DNA & cDNA
Ncbi symbol: CTH
Origin species: Human
Product name: CTH-cystathionase (cystathionine gamma-lyase) Gene
Size: 2ug
Accessions: BC015807
Gene id: 1491
Gene description: cystathionase (cystathionine gamma-lyase)
Synonyms: cystathionine gamma-lyase; cystathionase (cystathionine gamma-lyase); cysteine desulfhydrase; cysteine-protein sulfhydrase; gamma-cystathionase; homoserine deaminase; homoserine dehydratase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggaaaaagacgcctcctcacaaggtttcctgccacacttccaacatttcgccacgcaggcgatccatgtgggccaggatccagagcaatggacctccagggctgtagtgccccccatctcactgtccaccacgttcaagcaaggggcgcctggccagcactcgggttttgaatatagccgttctggaaatcccactaggaattgccttgaaaaagcagtggcagcactggatggggctaagtactgtttggcctttgcttcaggtttagcagccactgtaactattacccatcttttaaaagcaggagaccaaattatttgtatggatgatgtgtatggaggtacaaacaggtacttcaggcaagtggcatctgaatttggattaaagatttcttttgttgattgttccaaaatcaaattactagaggcagcaattacaccagaaaccaagcttgtttggatcgaaacccccacaaaccccacccagaaggtgattgacattgaaggctgtgcacatattgtccataagcatggagacattattttggtcgtggataacacttttatgtcaccatatttccagcgccctttggctctgggagctgatatttctatgtattctgcaacaaaatacatgaatggccacagtgatgttgtaatgggcctggtgtctgttaattgtgaaagccttcataatagacttcgtttcttgcaaaactctcttggagcagttccatctcctattgattgttacctctgcaatcgaggtctgaagactctacatgtccgaatggaaaagcatttcaaaaacggaatggcagttgcccagttcctggaatctaatccttgggtagaaaaggttatttatcctgggctgccctctcatccacagcatgagttggtgaagcgtcagtgtacaggttgtacagggatggtcaccttttatattaagggcactcttcagcatgctgagattttcctcaagaacctaaagctatttactctggccgagagcttgggaggattcgaaagccttgctgagcttccggcaatcatgactcatgcatcagttcttaagaatgacagagatgtccttggaattagtgacacactgattcgactttctgtgggcttagaggatgaggaagacctactggaagatctagatcaagctttgaaggcagcacaccctccaagtggaagtcacagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase kinase, isozyme 3
- testis derived transcript (3 LIM domains)
- coagulation factor II (thrombin) receptor
- zinc finger and BTB domain containing 8

Buy CTH-cystathionase (cystathionine gamma-lyase) Gene now

Add to cart