CXADR-coxsackie virus and adenovirus receptor Gene View larger

CXADR-coxsackie virus and adenovirus receptor Gene

PTXBC003684

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXADR-coxsackie virus and adenovirus receptor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXADR-coxsackie virus and adenovirus receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003684
Product type: DNA & cDNA
Ncbi symbol: CXADR
Origin species: Human
Product name: CXADR-coxsackie virus and adenovirus receptor Gene
Size: 2ug
Accessions: BC003684
Gene id: 1525
Gene description: coxsackie virus and adenovirus receptor
Synonyms: CAR4/6; HCAR; coxsackievirus and adenovirus receptor; 46 kD coxsackievirus and adenovirus receptor (CAR) protein; CVB3-binding protein; HCVADR; coxsackievirus B-adenovirus receptor; coxsackie virus and adenovirus receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctcctgctgtgcttcgtgctcctgtgcggagtagtggatttcgccagaagtttgagtatcactactcctgaagagatgattgaaaaagccaaaggggaaactgcctatctgccgtgcaaatttacgcttagtcccgaagaccagggaccgctggacatcgagtggctgatatcaccagctgataatcagaaggtggatcaagtgattattttatattctggagacaaaatttatgatgactactatccagatctgaaaggccgagtacattttacgagtaatgatctcaaatctggtgatgcatcaataaatgtaacgaatttacaactgtcagatattggcacatatcagtgcaaagtgaaaaaagctcctggtgttgcaaataagaagattcatctggtagttcttgttaagccttcaggtgcgagatgttacgttgatggatctgaagaaattggaagtgactttaagataaaatgtgaaccaaaagaaggttcacttccattacagtatgagtggcaaaaattgtctgactcacagaaaatgcccacttcatggttagcagaaatgacttcatctgttatatctgtaaaaaatgcctcttctgagtactctgggacatacagctgtacagtcagaaacagagtgggctctgatcagtgcctgttgcgtctaaacgttgtccctccttcaaataaagctggactaattgcaggagccattataggaactttgcttgctctagcgctcattggtcttatcatcttttgctgtcgtaaaaagcgcagagaagaaaaatatgaaaaggaagttcatcacgatatcagggaagatgtgccacctccaaagagccgtacgtccactgccagaagctacatcggcagtaatcattcatccctggggtccatgtctccttccaacatggaaggatattccaagactcagtataaccaagtaccaagtgaagactttgaacgcactcctcagagtccgactctcccacctgctaaggtagctgcccctaatctaagtcgaatgggtgcgattcctgtgatgattccagcacagagcaaggatgggtctatagtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - isocitrate dehydrogenase 3 (NAD+) gamma
- cystathionase (cystathionine gamma-lyase)
- pyruvate dehydrogenase kinase, isozyme 3
- testis derived transcript (3 LIM domains)

Buy CXADR-coxsackie virus and adenovirus receptor Gene now

Add to cart