Login to display prices
Login to display prices
AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene View larger

AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

PTXBC016728

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

Proteogenix catalog: PTXBC016728
Ncbi symbol: AASDHPPT
Product name: AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene
Size: 2ug
Accessions: BC016728
Gene id: 60496
Gene description: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Synonyms: AASD-PPT; ACPS; CGI-80; LYS2; L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase; 4'-phosphopantetheinyl transferase; LYS5 ortholog; alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase; holo ACP synthase; holo-[acyl-carrier-protein] synthase; aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggcagccatggctggtcgtctgatgataaggaaattagttgcagagaaattgaatatcccttggaatcatattcgtttgcaaagaactgcaaaaggaaaaccagttcttgcaaaggactcatcgaatccttacccgaatttcaactttaacatctctcatcaaggagactatgcagtgcttgctgctgaacctgagctgcaagttggaattgatataatgaagactagttttccaggtcgtggttcaattccagaattctttcatattatgaaaagaaagtttaccaacaaagaatgggaaacaatcagaagctttaaggatgagtggactcagctggatatgttttataggaattgggcacttaaggaaagcttcataaaagccattggtgttggactaggatttgaattgcagcggcttgaatttgatctatctccattaaacttggatataggccaagtttataaagaaacacgtttattcctggatggagaggaagaaaaagaatgggcatttgaggaaagcaaaatagatgagcaccattttgttgcagttgctcttaggaaacccgatggatctagacatcaggatgttccatctcaggatgattccaaaccaacccagaggcaatttactattctcaactttaatgatttaatgtcatctgccgttcccatgacacctgaagatccttcattttgggactgtttttgcttcacagaagaaattccaatacgaaatggtacaaagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: