Login to display prices
Login to display prices
GK5-glycerol kinase 5 (putative) Gene View larger

GK5-glycerol kinase 5 (putative) Gene

PTXBC032470

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GK5-glycerol kinase 5 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GK5-glycerol kinase 5 (putative) Gene

Proteogenix catalog: PTXBC032470
Ncbi symbol: GK5
Product name: GK5-glycerol kinase 5 (putative) Gene
Size: 2ug
Accessions: BC032470
Gene id: 256356
Gene description: glycerol kinase 5 (putative)
Synonyms: ATP:glycerol 3-phosphotransferase 5; GK 5; glycerokinase 5; glycerol kinase 5 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggggctgctcacggacccggagcagagagcgcaggagccgcggtaccccggcttcgtgctggggctggatgtgggcagttctgtgatccgctgccacgtctatgaccgggcggcgcgggtctgcggctccagcgtgcagaaggtagaaaatctttatcctcaaattggctgggtagaaattgatcctgatgttctttggattcaatttgttgccgtaataaaagaagcagtcaaagctgcaggaatacagatgaatcaaattgttggtcttggcatttcaacacagagagcaacttttattacgtggaacaagaaaacaggaaatcattttcacaactttataagttggcaagacttaagagctgttgaacttgtaaaatcttggaataattctcttcttatgaagatatttcacagttcttgccgagtgcttcactttttcactagaagtaaacgactttttacagccagtttgttcactttcacaacccagcagacttctttgagattggtctggattttacagaacttgactgaggtgcaaaaggcagttgaagaagaaaattgctgctttgggactattgatacctggttgttatataagctcacaaaaggttctgtatatgccacagatttttcaaatgctagtacaactggactttttgacccatataagatgtgttggagtgggatgattacctctctaatttcgataccactttctctcctacctcctgtgagggacacaagccacaattttggatcagtggatgaagagatatttggtgtgcctataccaatagttgccttgttaaaggtccctggatatgaccagaatatctgctatatttttgggaaggggaccattgagccagtattctatcatggaagtactttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: