CSDA-cold shock domain protein A Gene View larger

CSDA-cold shock domain protein A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSDA-cold shock domain protein A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSDA-cold shock domain protein A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015564
Product type: DNA & cDNA
Ncbi symbol: CSDA
Origin species: Human
Product name: CSDA-cold shock domain protein A Gene
Size: 2ug
Accessions: BC015564
Gene id: 8531
Gene description: cold shock domain protein A
Synonyms: CSDA; CSDA1; DBPA; ZONAB; Y-box-binding protein 3; DNA-binding protein A; ZO-1-associated nucleic acid-binding protein; cold shock domain-containing protein A; cold-shock domain containing A1; cold-shock domain protein A; single-strand DNA-binding protein NF-GMB; Y-box binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaggcgggcgaggccaccaccaccaccaccaccaccctcccgcaggctccgacggaggcggccgccgcggctccccaggaccccgcgcccaagagcccggtgggcagcggtgcgccccaggccgcggccccggcgcccgccgcccacgtcgcaggaaaccccggtggggacgcggcccccgcagccacgggcaccgcggccgccgcctctttagccaccgccgccggcagcgaagacgcggagaaaaaagttctcgccaccaaagtccttggcactgtcaaatggttcaacgtcagaaatggatatggatttataaatcgaaatgacaccaaagaagatgtatttgtacatcagactgccatcaagaagaataacccacggaaatatctgcgcagtgtaggagatggagaaactgtagagtttgatgtggttgaaggagagaagggtgcagaagctgccaatgtgactggcccggatggagttcctgtggaagggagtcgttacgctgcagatcggcgccgttacagacgtggctactatggaaggcgccgtggccctccccggaattacgctggggaggaggaggaggaagggagcggcagcagtgaaggatttgacccccctgccactgataggcagttctctggggcccggaatcagctgcgccgcccccagtatcgccctcagtaccggcagcggcggttcccgccttaccacgtgggacagacctttgaccgtcgctcacgggtcttaccccatcccaacagaatacaggctggtgagattggagagatgaaggatggagtcccagagggagcacaacttcagggaccggttcatcgaaatccaacttaccgcccaaggtaccgtagcaggggacctcctcgcccacgacctgccccagcagttggagaggctgaagataaagaaaatcagcaagccaccagtggtccaaaccagccgtctgttcgccgtggataccggcgtccctacaattaccggcgtcgcccgcgtcctcctaacgctccttcacaagatggcaaagaggccaaggcaggtgaagcaccaactgagaaccctgctccacccacccagcagagcagtgctgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch domain containing 3
- kelch domain containing 2
- casein kinase 1, gamma 2
- hyaluronoglucosaminidase 3

Buy CSDA-cold shock domain protein A Gene now

Add to cart