HYAL3-hyaluronoglucosaminidase 3 Gene View larger

HYAL3-hyaluronoglucosaminidase 3 Gene

PTXBC012892

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HYAL3-hyaluronoglucosaminidase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HYAL3-hyaluronoglucosaminidase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012892
Product type: DNA & cDNA
Ncbi symbol: HYAL3
Origin species: Human
Product name: HYAL3-hyaluronoglucosaminidase 3 Gene
Size: 2ug
Accessions: BC012892
Gene id: 8372
Gene description: hyaluronoglucosaminidase 3
Synonyms: HYAL-3; LUCA-3; LUCA3; hyaluronidase-3; lung carcinoma protein 3; hyaluronoglucosaminidase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacgcaactgggcccagccctggtgctgggggtggccctgtgcctgggttgtggccagcccctaccacaggtccctgaacgccccttctctgtgctgtggaatgtaccctcagcacactgtgaggcccgctttggtgtgcacctgccactcaatgctctgggcatcatagccaaccgtggccagcattttcacggtcagaacatgaccattttctacaagaaccaactcggcctctatccctactttggacccaggggcacagctcacaatgggggcatcccccaggctttgccccttgaccgccacctggcactggctgcctaccagatctaccacagcctgagacctggctttgctggcccagcagtgctggattgggaggagtggtgtccactctgggctgggaactggggccgccgccgagcttatcaggcagcctcttgggcttgggcacagcaggtattccctgacctggaccctcaggagcagctctacaaggcctatactggctttgagcaggcggcccgtgcactgatggaggatacgctgcgggtggcccaggcactacggccccatggactctggggcttctatcactacccagcctgtggcaatggctggcatagtatggcttccaactataccggccgctgccatgcagccacccttgcccgcaacactcaactgcattggctctgggccgcctccagtgccctcttccccagcatctacctcccacccaggctgccacctgcccaccaccaggcctttgtccgacatcgcctggaggaggccttccgtgtggcccttgttgggcaccgacatcccctgcctgtcctggcctatgtccgcctcacacaccggagatctgggaggttcctgtcccaggatgaccttgtgcagtccattggtgtgagtgcagcactaggggcagccggcgtggtgctctggggggacctgagcctctccagctctgaggaggagtgctggcatctccatgactacctggtggacaccttgggcccctatgtgatcaatgtgaccagggcagcgatggcctgcagtcaccagcggtgccatggccacgggcgctgtgcccggcgagatccaggacagatggaagcctttctacacctgtggccagacggcagccttggagattggaagtccttcagctgccactgttactggggctgggctggccccacctgccaggagcccaggcctgggcctaaagaagcagtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RGM domain family, member A
- TEA domain family member 2
- MYC induced nuclear antigen
- kelch domain containing 4

Buy HYAL3-hyaluronoglucosaminidase 3 Gene now

Add to cart