MINA-MYC induced nuclear antigen Gene View larger

MINA-MYC induced nuclear antigen Gene

PTXBC014928

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MINA-MYC induced nuclear antigen Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MINA-MYC induced nuclear antigen Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014928
Product type: DNA & cDNA
Ncbi symbol: MINA
Origin species: Human
Product name: MINA-MYC induced nuclear antigen Gene
Size: 2ug
Accessions: BC014928
Gene id: 84864
Gene description: MYC induced nuclear antigen
Synonyms: ribosomal oxygenase MINA; histone lysine demethylase MINA; bifunctional lysine-specific demethylase and histidyl-hydroxylase MINA; MDIG; MINA53; NO52; ROX; 60S ribosomal protein L27a histidine hydroxylase; mineral dust induced gene protein; myc-induced nuclear antigen, 53 kDa; nucleolar protein 52; MYC induced nuclear antigen
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaagaaagcaaagcctacagggagtgggaaggaagaggggccggctccctgtaagcagatgaagttagaagcagctggggggccttcagctttaaactttgacagtcccagtagtctctttgaaagtttaatctcgcccatcaagacagagacttttttcaaggaattctgggagcagaagccccttctcattcagagagatgaccctgcactggccacatactatgggtccctgttcaagctaacagatctgaagagtctgtgcagccgggggatgtactatggaagagatgtgaatgtctgccggtgtgtcaatgggaagaagaaggttttaaataaagatggcaaagcacactttcttcagctgagaaaagattttgatcagaaaagggcaacgattcagtttcaccaacctcagagatttaaggatgagctttggaggatccaggagaagctggaatgttactttggctccttggttggctcgaatgtgtacataactcccgcaggatctcagggcctgccgccccattatgatgatgtcgaggttttcatcctgcagctggagggagagaaacactggcgcctctaccaccccactgtgcccctggcacgagagtacagcgtggaggccgaggaaaggatcggcaggccggtgcatgagtttatgctgaagccgggtgatttgttgtactttcccagaggaaccattcatcaagcggacactcctgcggggctggcccactcgactcacgtgaccatcagcacctaccagaacaattcatggggagatttccttttggataccatctcggggcttgtatttgatactgcaaaggaagacgtggagttacggaccggcataccccggcagctgctcctgcaggtggaatccacaactgttgctacaagacgattaagtggcttcctgaggacacttgcagaccggctggagggcaccaaagaactgctttcctcagacatgaagaaggattttattatgcacagactccccccttactctgcgggagatggggcagagctgtcaacaccaggtggaaagttaccgaggctggacagtgtagtgagactgcagtttaaagaccacattgtcctcacagtactgccggatcaagatcaatctgatgaaactcaagaaaagatggtgtacatctatcattccttaaagaatagtagagagacacacatgatgggaaatgaggaggaaacagagtttcatggacttcgcttccctttgtcacatttggatgcactgaagcaaatttggaatagtccagctatttctgtcaaggacctgaaacttactacagatgaggaaaaggaaagcctggtattatccctctggacagaatgtttaattcaagtagtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch domain containing 4
- nicalin homolog (zebrafish)
- heat shock 70kDa protein 2
- heat shock 70kDa protein 8

Buy MINA-MYC induced nuclear antigen Gene now

Add to cart