FKBPL-FK506 binding protein like Gene View larger

FKBPL-FK506 binding protein like Gene

PTXBC004168

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBPL-FK506 binding protein like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBPL-FK506 binding protein like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004168
Product type: DNA & cDNA
Ncbi symbol: FKBPL
Origin species: Human
Product name: FKBPL-FK506 binding protein like Gene
Size: 2ug
Accessions: BC004168
Gene id: 63943
Gene description: FK506 binding protein like
Synonyms: DIR1; FKBP4; NG7; WISP39; FK506-binding protein-like; WAF-1/CIP1 stabilizing protein 39; peptidyl-prolyl cis-trans isomerase; FK506 binding protein like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgccaccagtcaatacaattggagaaaaggacacctctcagccgcaacaagagtgggaaaagaaccttcgggagaaccttgattcagttattcagattaggcagcagccccgagaccctcctaccgaaacgcttgagctggaagtaagcccagatccagccagccaaattctagagcatactcaaggagctgaaaaactggttgctgaacttgaaggagactctcataagtctcatggatcaaccagtcagatgccagaggcccttcaagcttctgatctctggtactgccccgatgggagctttgtcaagaagatcgtaatccgtggccatggcttggacaaacccaaactaggctcctgctgccgggtactggctttggggtttcctttcggatcagggccgccagagggctggacagagctaactatgggcgtagggccatggagggaggaaacttggggggagctcatagagaaatgcttggagtccatgtgtcaaggtgaggaagcagagcttcagctgcctgggcactctggacctcctgtcaggctcacactggcatccttcactcaaggccgagactcctgggagctggagactagcgagaaggaagccctggccagggaagaacgtgcaaggggcacagaactatttcgagctgggaaccctgaaggagctgcccgatgctatggacgggctcttcggctgctcctgactttacccccacctggccctccagaacgaactgtccttcatgccaatctggctgcctgtcagttgttgctagggcagcctcagttggcagcccagagctgtgaccgggtgttggagcgggagcctggccatttaaaggccttataccgaaggggggttgcccaggctgcccttgggaacctggaaaaagcaactgctgacctcaagaaggtgctggcgatagatcccaaaaaccgggcagcccaggaggaactggggaaggtggtcattcaggggaagaaccaggatgcagggctggctcagggtctgcgcaagatgtttggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cold shock domain protein A
- kelch domain containing 3
- kelch domain containing 2
- casein kinase 1, gamma 2

Buy FKBPL-FK506 binding protein like Gene now

Add to cart