Cart 1 Product Products 256,00 € (empty)
No products
To be determined Shipping
256,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 256,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 256,00 €
Data sheet of FKBPL-FK506 binding protein like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBPL-FK506 binding protein like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBPL |
| Origin species: | Human |
| Product name: | FKBPL-FK506 binding protein like Gene |
| Size: | 2ug |
| Accessions: | BC004168 |
| Gene id: | 63943 |
| Gene description: | FK506 binding protein like |
| Synonyms: | DIR1; FKBP4; NG7; WISP39; FK506-binding protein-like; WAF-1/CIP1 stabilizing protein 39; peptidyl-prolyl cis-trans isomerase; FK506 binding protein like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacgccaccagtcaatacaattggagaaaaggacacctctcagccgcaacaagagtgggaaaagaaccttcgggagaaccttgattcagttattcagattaggcagcagccccgagaccctcctaccgaaacgcttgagctggaagtaagcccagatccagccagccaaattctagagcatactcaaggagctgaaaaactggttgctgaacttgaaggagactctcataagtctcatggatcaaccagtcagatgccagaggcccttcaagcttctgatctctggtactgccccgatgggagctttgtcaagaagatcgtaatccgtggccatggcttggacaaacccaaactaggctcctgctgccgggtactggctttggggtttcctttcggatcagggccgccagagggctggacagagctaactatgggcgtagggccatggagggaggaaacttggggggagctcatagagaaatgcttggagtccatgtgtcaaggtgaggaagcagagcttcagctgcctgggcactctggacctcctgtcaggctcacactggcatccttcactcaaggccgagactcctgggagctggagactagcgagaaggaagccctggccagggaagaacgtgcaaggggcacagaactatttcgagctgggaaccctgaaggagctgcccgatgctatggacgggctcttcggctgctcctgactttacccccacctggccctccagaacgaactgtccttcatgccaatctggctgcctgtcagttgttgctagggcagcctcagttggcagcccagagctgtgaccgggtgttggagcgggagcctggccatttaaaggccttataccgaaggggggttgcccaggctgcccttgggaacctggaaaaagcaactgctgacctcaagaaggtgctggcgatagatcccaaaaaccgggcagcccaggaggaactggggaaggtggtcattcaggggaagaaccaggatgcagggctggctcagggtctgcgcaagatgtttggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cold shock domain protein A - kelch domain containing 3 - kelch domain containing 2 - casein kinase 1, gamma 2 |