Login to display prices
Login to display prices
RALYL-RALY RNA binding protein-like Gene View larger

RALYL-RALY RNA binding protein-like Gene

PTXBC031090

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RALYL-RALY RNA binding protein-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RALYL-RALY RNA binding protein-like Gene

Proteogenix catalog: PTXBC031090
Ncbi symbol: RALYL
Product name: RALYL-RALY RNA binding protein-like Gene
Size: 2ug
Accessions: BC031090
Gene id: 138046
Gene description: RALY RNA binding protein-like
Synonyms: HNRPCL3; RNA-binding Raly-like protein; heterogeneous nuclear ribonucleoprotein C-like 3; hnRNP core protein C-like 3; RALY RNA binding protein-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactggcaaaacacagaccagcaacgtcaccaataagaatgaccccaagtccatcaactcccgtgttttcatcggcaatctaaatacggcaattgtcaagaaagttgacattgaagccattttttcaaagtatggaaaaatagttggatgttccgttcacaaaggttatgcatttgtacagtacatgagtgagcgacatgcaagagctgcagtggctggagaaaatgccagagtcatcgccggccaaccacttgatatcaacatggcaggagagcccaaaccatacagaccaaaacctggaaacaagaggcccctttctgcactttacagacttgaatcaaaggaacctttcctgtctgttggcggttatgtctttgactatgattactacagagatgatttctacaatcggttatttgattaccacgggcgtgtgcctccacctccccgtgcagtaattccgctgaagcgtcccagagtggcagtcacaacgactcgcagggggaaaggagtcttttccatgaaaggtggatcgagatctactgccagtgggtcaacaggttctaaattgaaatcagatgagttacagaccatcaagaaagaattaacccagatcaaaactaaaattgactccttgctagggcgcctggagaagattgagaaacagcagaaggcggaggcagaagctcagaagaagcaattggaagagagtctagtgctgatccaagaggaatgtgtgtcagagattgcagatcactctacagaggagcctgctgaaggagggccagatgccgatggagaagagatgacagatgggatagaggaggacttcgatgaagatgggggtcatgagctgtttctacagataaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: