GPM6A-glycoprotein M6A Gene View larger

GPM6A-glycoprotein M6A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPM6A-glycoprotein M6A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPM6A-glycoprotein M6A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022508
Product type: DNA & cDNA
Ncbi symbol: GPM6A
Origin species: Human
Product name: GPM6A-glycoprotein M6A Gene
Size: 2ug
Accessions: BC022508
Gene id: 2823
Gene description: glycoprotein M6A
Synonyms: GPM6; M6A; neuronal membrane glycoprotein M6-a; glycoprotein M6A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagagaatatggaagagggacagacacaaaaagggtgttttgaatgctgtatcaaatgcctggggggcattccctatgcctctctgattgccaccatcctgctctatgcgggtgttgccctgttctgtggctgcggtcatgaagcgctttctggaactgtcaacattctgcaaacctactttgagatggcaagaactgctggagacacactggatgtttttaccatgattgacatctttaagtatgtgatctacggcatcgcagctgcgttctttgtgtatggcattttgctgatggtggaaggtttcttcacaactggggccatcaaagatctctatggggatttcaaaatcaccacttgtggcagatgtgtgagcgcttggttcattatgctgacatatcttttcatgttggcctggctgggagtcacggctttcacctcactgccagtttacatgtacttcaatctgtggaccatctgccggaacaccacattagtggagggagcaaatctctgcttggaccttcgtcagtttggaattgtgacaattggagaggaaaagaaaatttgtactgtctctgagaatttcttgaggatgtgcgaatctactgagctgaacatgaccttccacttgtttattgtggcacttgctggagctggggcagcagtcattgctatggttcactaccttatggttctgtctgccaactgggcctatgtgaaagacgcctgccggatgcagaagtatgaagacatcaagtcgaaggaagagcaagagcttcatgacatccactctactcgctccaaagagcggctcaatgcatacacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 15
- calpain 3, (p94)
- GPN-loop GTPase 2
- transaldolase 1

Buy GPM6A-glycoprotein M6A Gene now

Add to cart