TSPAN15-tetraspanin 15 Gene View larger

TSPAN15-tetraspanin 15 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN15-tetraspanin 15 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN15-tetraspanin 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003157
Product type: DNA & cDNA
Ncbi symbol: TSPAN15
Origin species: Human
Product name: TSPAN15-tetraspanin 15 Gene
Size: 2ug
Accessions: BC003157
Gene id: 23555
Gene description: tetraspanin 15
Synonyms: 2700063A19Rik; NET-7; NET7; TM4SF15; tetraspanin-15; tetraspan NET-7; transmembrane 4 superfamily member 15; transmembrane 4 superfamily member tetraspan NET-7; tspan-15; tetraspanin 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgcggggactcggagcaggtgcgctactgcgcgcgcttctcctacctctggctcaagttttcacttatcatctattccaccgtgttctggctgattggggccctggtcctgtctgtgggcatctatgcagaggttgagcggcagaaatataaaacccttgaaagtgccttcctggctccagccatcatcctcatcctcctgggcgtcgtcatgttcatggtctccttcattggtgtgctggcgtccctccgtgacaacctgtaccttctccaagcattcatgtacatccttgggatctgcctcatcatggagctcattggtggcgtggtggccttgaccttccggaaccagaccattgacttcctgaacgacaacattcgaagaggaattgagaactactatgatgatctggacttcaaaaacatcatggactttgttcagaaaaagttcaagtgctgtggcggggaggactaccgagattggagcaagaatcagtaccacgactgcagtgcccctggacccctggcctgtggggtgccctacacctgctgcatcaggaacacgacagaagttgtcaacaccatgtgtggctacaaaactatcgacaaggagcgtttcagtgtgcaggatgtcatctacgtgcggggctgcaccaacgccgtgatcatctggttcatggacaactacaccatcatggcgggcatcctcctgggcatcctgcttccccagttcctgggggtgctgctgacgctgctgtacatcacccgggtggaggacatcatcatggagcactctgtcactgatgggctccttgggcccggtgccaagcccagcgtggaggcggcaggcacgggatgctgcttgtgctaccccaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calpain 3, (p94)
- GPN-loop GTPase 2
- transaldolase 1
- sorting nexin 15

Buy TSPAN15-tetraspanin 15 Gene now

Add to cart