Login to display prices
Login to display prices
GPN2-GPN-loop GTPase 2 Gene View larger

GPN2-GPN-loop GTPase 2 Gene

PTXBC008634

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPN2-GPN-loop GTPase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPN2-GPN-loop GTPase 2 Gene

Proteogenix catalog: PTXBC008634
Ncbi symbol: GPN2
Product name: GPN2-GPN-loop GTPase 2 Gene
Size: 2ug
Accessions: BC008634
Gene id: 54707
Gene description: GPN-loop GTPase 2
Synonyms: ATPBD1B; GPN-loop GTPase 2; ATP-binding domain 1 family member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggggccgctccgaccacggccttcgggcaggcggtgatcggcccgccgggttcagggaagaccacgtactgcctgggcatgagtgagttcctgcgcgcgctgggccggcgcgtggcggtggtgaacctggacccggccaacgaggggctgccgtacgagtgtgccgtggacgtgggcgagctggtggggctgggcgacgtgatggacgcgctgcgcctggggcccaacggcggcctgctctactgcatggagtacctggaagccaacctggactggctgcgtgccaagctcgaccccctccgcggccactacttcctcttcgactgcccaggccaggtggagctctgcacgcatcacggcgccttgcgcagcatcttctcccaaatggcgcagtgggacctcaggctgactgccgtccacctcgtggattctcactactgcacagaccctgccaagttcatttcagtactgtgtacctccctggccaccatgctgcacgtggaactgccccacatcaacctcctttccaagatggacctcattgagcattatgggaagctggccttcaacctggactactacacagaggttctggacctctcctacctgcttgaccacctggcttctgaccctttcttccgccactaccgccagctcaatgagaagctagtgcggctcatcgaagactatagccttgtctcctttatccctctcaacatccaggacaaggagagcatccagcgagtcctgcaggctgtggataaagccaatggatactgtttcggagcccaagagcagcgaagcttggaagccatgatgtctgccgcaatgggagccgacttccatttctcttccacactgggcatccaggagaagtacctggcaccctcgaaccagtcagtggagcaggaagccatgcagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice