THAP10-THAP domain containing 10 Gene View larger

THAP10-THAP domain containing 10 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP10-THAP domain containing 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THAP10-THAP domain containing 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027857
Product type: DNA & cDNA
Ncbi symbol: THAP10
Origin species: Human
Product name: THAP10-THAP domain containing 10 Gene
Size: 2ug
Accessions: BC027857
Gene id: 56906
Gene description: THAP domain containing 10
Synonyms: THAP domain-containing protein 10; THAP domain containing 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggcccgttgtgtggccgcccactgcggcaacaccaccaagtctgggaagtcgctgttccgctttcccaaggaccgggccgtgcggctgctctgggaccgcttcgtgcggggttgccgcgccgactggtacggaggcaatgaccgctcggtcatctgctctgaccactttgccccagcctgttttgacgtctcttcggttatccagaagaacctgcgcttctcccagcgcctgaggctggtggcaggcgccgtgcccaccctgcaccgggtgcccgccccggcacctaagaggggagaggagggagaccaagcaggccgcctggacacgcgaggagagctccaggcagccaggcattctgaggctgccccaggtccagtctcctgtacacgcccccgagctgggaagcaggctgcagcttcacagattacgtgtgaaaatgaacttgtgcaaacccaaccccatgctgataatccatctaatactgtcacttcagtacctactcactgtgaagaaggcccagtgcataaaagtacacaaatttctttgaaaaggccccgtcaccgtagtgtgggtattcaagccaaagtgaaagcgtttggaaaaagactgtgtaatgcaactactcagacagaggaattgtggtctagaacttcctctctctttgacatttactccagtgattcagaaacagatacagactgggatatcaagagtgaacagagtgatttgtcttatatggctgtacaggtgaaagaagaaacatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 7
- glycerol kinase 5 (putative)
- DDRGK domain containing 1
- FK506 binding protein like

Buy THAP10-THAP domain containing 10 Gene now

Add to cart