PRNP-prion protein Gene View larger

PRNP-prion protein Gene

PTXBC012844

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRNP-prion protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRNP-prion protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012844
Product type: DNA & cDNA
Ncbi symbol: PRNP
Origin species: Human
Product name: PRNP-prion protein Gene
Size: 2ug
Accessions: BC012844
Gene id: 5621
Gene description: prion protein
Synonyms: ASCR; AltPrP; CD230; CJD; GSS; KURU; PRIP; PrP; PrP27-30; PrP33-35C; PrPc; p27-30; major prion protein; alternative prion protein; CD230 antigen; prion-related protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtggtggctgggggcagccccatggtggtggctggggacagcctcatggtggtggctggggtcaaggaggtggcacccacagtcagtggaacaagccgagtaagccaaaaaccaacatgaagcacatggctggtgctgcagcagctggggcagtggtggggggccttggcggctacgtgctgggaagtgccatgagcaggcccatcatacatttcggcagtgactatgaggaccgttactatcgtgaaaacatgcaccgttaccccaaccaagtgtactacaggcccatggatgagtacagcaaccagaacaactttgtgcacgactgcgtcaatatcacaatcaagcagcacacggtcaccacaaccaccaagggggagaacttcaccgagaccgacgttaagatgatggagcgcgtggttgagcagatgtgtatcacccagtacgagagggaatctcaggcctattaccagagaggatcgagcatggtcctcttctcctctccacctgtgatcctcctgatctctttcctcatcttcctgatagtgggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - bestrophin 3
- CD14 molecule
- B-cell linker
- CD99 molecule

Buy PRNP-prion protein Gene now

Add to cart