Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene
PTXBC015514
New product
Data sheet of TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFPI |
| Origin species: | Human |
| Product name: | TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene |
| Size: | 2ug |
| Accessions: | BC015514 |
| Gene id: | 7035 |
| Gene description: | tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) |
| Synonyms: | EPI; LACI; TFI; TFPI1; anti-convertin; extrinsic pathway inhibitor; tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatttacacaatgaagaaagtacatgcactttgggcttctgtatgcctgctgcttaatcttgcccctgcccctcttaatgctgattctgaggaagatgaagaacacacaattatcacagatacggagttgccaccactgaaacttatgcattcattttgtgcattcaaggcggatgatggcccatgtaaagcaatcatgaaaagatttttcttcaatattttcactcgacagtgcgaagaatttatatatgggggatgtgaaggaaatcagaatcgatttgaaagtctggaagagtgcaaaaaaatgtgtacaagagataatgcaaacaggattataaagacaacattgcaacaagaaaagccagatttctgctttttggaagaagatcctggaatatgtcgaggttatattaccaggtatttttataacaatcagacaaaacagtgtgaacgtttcaagtatggtggatgcctgggcaatatgaacaattttgagacactggaagaatgcaagaacatttgtgaagatggtccgaatggtttccaggtggataattatggaacccagctcaatgctgtgaataactccctgactccgcaatcaaccaaggttcccagcctttttgttacaaaagaaggaacaaatgatggttggaagaatgcggctcatatttaccaagtctttctgaacgccttctgcattcatgcatccatgttctttctaggattggatagcatttcatgcctatgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like - T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 - TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa - platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa |