TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene View larger

TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene

PTXBC015514

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015514
Product type: DNA & cDNA
Ncbi symbol: TFPI
Origin species: Human
Product name: TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene
Size: 2ug
Accessions: BC015514
Gene id: 7035
Gene description: tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Synonyms: EPI; LACI; TFI; TFPI1; anti-convertin; extrinsic pathway inhibitor; tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatttacacaatgaagaaagtacatgcactttgggcttctgtatgcctgctgcttaatcttgcccctgcccctcttaatgctgattctgaggaagatgaagaacacacaattatcacagatacggagttgccaccactgaaacttatgcattcattttgtgcattcaaggcggatgatggcccatgtaaagcaatcatgaaaagatttttcttcaatattttcactcgacagtgcgaagaatttatatatgggggatgtgaaggaaatcagaatcgatttgaaagtctggaagagtgcaaaaaaatgtgtacaagagataatgcaaacaggattataaagacaacattgcaacaagaaaagccagatttctgctttttggaagaagatcctggaatatgtcgaggttatattaccaggtatttttataacaatcagacaaaacagtgtgaacgtttcaagtatggtggatgcctgggcaatatgaacaattttgagacactggaagaatgcaagaacatttgtgaagatggtccgaatggtttccaggtggataattatggaacccagctcaatgctgtgaataactccctgactccgcaatcaaccaaggttcccagcctttttgttacaaaagaaggaacaaatgatggttggaagaatgcggctcatatttaccaagtctttctgaacgccttctgcattcatgcatccatgttctttctaggattggatagcatttcatgcctatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like
- T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
- platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa

Buy TFPI-tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Gene now

Add to cart