Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene
PTXBC009631
New product
Data sheet of DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009631 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCI |
| Origin species: | Human |
| Product name: | DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene |
| Size: | 2ug |
| Accessions: | BC009631 |
| Gene id: | 1632 |
| Gene description: | dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) |
| Synonyms: | DCI; enoyl-CoA delta isomerase 1, mitochondrial; 3,2 trans-enoyl-Coenzyme A isomerase; 3,2-trans-enoyl-CoA isomerase, mitochondrial; D3,D2-enoyl-CoA isomerase; acetylene-allene isomerase; delta(3),Delta(2)-enoyl-CoA isomerase; dodecenoyl-CoA delta isomerase (3,2 trans-enoyl-CoA isomerase); dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase); enoyl-CoA delta isomerase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaattcaagaaccccccagtgaacagcctgagcctggagtttctgacggagctggtcatcagcctggagaagctggagaatgacaagagcttccgcggtgtcattctgacctcggaccgcccgggtgtcttctcggccggcctggacctgacggagatgtgtgggaggagccccgcccactacgctgggtactggaaggccgttcaggagctgtggctgcggttgtaccagtccaacctggtgctggtctccgccatcaacggagcctgccccgctggaggctgcctggtggccctgacctgtgactaccgcatcctggcggacaaccccaggtactgcataggactcaatgagacccagctgggcatcatcgcccctttctggttgaaagacaccctggagaacaccatcgggcaccgggcggcggagcgtgccctgcagctggggctgctcttcccgccggcggaggccctgcaggtgggcatagtggaccaggtggtcccggaggagcaggtgcagagcactgcgctgtcagcgatagcccagtggatggccattccagaccatgctcgacagctgaccaaggccatgatgcgaaaggccacggccagccgcctggtcacgcagcgcgatgcggacgtgcagaacttcgtcagcttcatctccaaagactccatccagaagtccctgcagatgtacttagagaggctcaaagaagaaaaaggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase - glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) - mitogen-activated protein kinase kinase kinase 7 interacting protein 3 - KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 |