Login to display prices
Login to display prices
DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene View larger

DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene

PTXBC009631

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene

Proteogenix catalog: PTXBC009631
Ncbi symbol: DCI
Product name: DCI-dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) Gene
Size: 2ug
Accessions: BC009631
Gene id: 1632
Gene description: dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)
Synonyms: DCI; enoyl-CoA delta isomerase 1, mitochondrial; 3,2 trans-enoyl-Coenzyme A isomerase; 3,2-trans-enoyl-CoA isomerase, mitochondrial; D3,D2-enoyl-CoA isomerase; acetylene-allene isomerase; delta(3),Delta(2)-enoyl-CoA isomerase; dodecenoyl-CoA delta isomerase (3,2 trans-enoyl-CoA isomerase); dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase); enoyl-CoA delta isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaattcaagaaccccccagtgaacagcctgagcctggagtttctgacggagctggtcatcagcctggagaagctggagaatgacaagagcttccgcggtgtcattctgacctcggaccgcccgggtgtcttctcggccggcctggacctgacggagatgtgtgggaggagccccgcccactacgctgggtactggaaggccgttcaggagctgtggctgcggttgtaccagtccaacctggtgctggtctccgccatcaacggagcctgccccgctggaggctgcctggtggccctgacctgtgactaccgcatcctggcggacaaccccaggtactgcataggactcaatgagacccagctgggcatcatcgcccctttctggttgaaagacaccctggagaacaccatcgggcaccgggcggcggagcgtgccctgcagctggggctgctcttcccgccggcggaggccctgcaggtgggcatagtggaccaggtggtcccggaggagcaggtgcagagcactgcgctgtcagcgatagcccagtggatggccattccagaccatgctcgacagctgaccaaggccatgatgcgaaaggccacggccagccgcctggtcacgcagcgcgatgcggacgtgcagaacttcgtcagcttcatctccaaagactccatccagaagtccctgcagatgtacttagagaggctcaaagaagaaaaaggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: