RNF125-ring finger protein 125 Gene View larger

RNF125-ring finger protein 125 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF125-ring finger protein 125 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNF125-ring finger protein 125 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012021
Product type: DNA & cDNA
Ncbi symbol: RNF125
Origin species: Human
Product name: RNF125-ring finger protein 125 Gene
Size: 2ug
Accessions: BC012021
Gene id: 54941
Gene description: ring finger protein 125
Synonyms: E3 ubiquitin-protein ligase RNF125; TNORS; TRAC-1; TRAC1; T-cell RING activation protein 1; T-cell ring protein identified in activation screen; ring finger protein 125, E3 ubiquitin protein ligase; ring finger protein 125
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctccgtgctgagcaccgacagcggcaaatcggcgcccgcctctgccaccgcgcgggccctggagcgcaggagggacccggagttgcccgtcacgtccttcgactgcgccgtgtgccttgaggtgttacaccagcctgtccggacccgctgtggccacgtattctgccgttcctgtattgctaccagtctaaagaacaacaagtggacctgtccttattgccgggcatatcttccttcagaaggagttccagcaactgatgtagccaaaagaatgaaatcagagtataagaactgcgctgagtgtgacatagttctttacctcagtgaaatgagggcacatattcggacttgtcagaagtacatagataagtatggaccactacaagaacttgaggagacagcagcaaggtgtgtatgtcccttttgtcagagggaactgtatgaagacagcttgctggatcattgtattactcatcacagatcggaacggaggcctgtgttctgtccactttgccgtttaatacccgatgagaatccaagcagcttcagtggcagtttaataagacatctgcaagttagtcacactttgttttatgatgatttcatagattttaatataattgaggaagctcttatccgaagagtcttagaccggtcacttcttgaatatgtgaatcactcgaacacagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 174
- APAF1 interacting protein
- ring finger protein 182
- MIF4G domain containing

Buy RNF125-ring finger protein 125 Gene now

Add to cart