ZNF174-zinc finger protein 174 Gene View larger

ZNF174-zinc finger protein 174 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF174-zinc finger protein 174 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF174-zinc finger protein 174 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000876
Product type: DNA & cDNA
Ncbi symbol: ZNF174
Origin species: Human
Product name: ZNF174-zinc finger protein 174 Gene
Size: 2ug
Accessions: BC000876
Gene id: 7727
Gene description: zinc finger protein 174
Synonyms: ZSCAN8; zinc finger protein 174; AW-1; zinc finger and SCAN domain-containing protein 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctaaaatggagataactttaagctccaacactgaagcttcctccaagcaagagagacacataatagccaaactagaagagaaacggggccctcctctgcaaaaaaactgcccagatcctgagctctgccgccagagcttcagacgcttttgttatcaagaggtgtctggaccccaagaggcgctctcccagctccgacagctctgccgtcagtggttgcaacccgagctgcacaccaaggagcagattttggagcttctggtgatggagcagttcctgaccatcctgcccccggagatccaggctcgggtcaggcatcgatgtccaatgagcagcaaggagattgtgaccctcgtggaagattttcacagagcatccaagaaaccaaagcagtgggtggccgtttgtatgcaggggcaaaaggtgctcttggagaaaactggatctcagcttggagaacaggaactgccagactttcaaccgcagactcctaggagagatctcagggagagctctccagcagagccttcccaggcaggagcttatgaccggctgagcccccatcattgggagaaatccccactcctccaagaaccaacccccaaattggctgggacagaacttcttatagaaaagacagatccaaatatggccacagatgaacttccatgcaagctatggctgagtttcattgcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - APAF1 interacting protein
- ring finger protein 182
- MIF4G domain containing
- FERM domain containing 6

Buy ZNF174-zinc finger protein 174 Gene now

Add to cart