Login to display prices
Login to display prices
ZNF174-zinc finger protein 174 Gene View larger

ZNF174-zinc finger protein 174 Gene

PTXBC000876

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF174-zinc finger protein 174 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF174-zinc finger protein 174 Gene

Proteogenix catalog: PTXBC000876
Ncbi symbol: ZNF174
Product name: ZNF174-zinc finger protein 174 Gene
Size: 2ug
Accessions: BC000876
Gene id: 7727
Gene description: zinc finger protein 174
Synonyms: ZSCAN8; zinc finger protein 174; AW-1; zinc finger and SCAN domain-containing protein 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctaaaatggagataactttaagctccaacactgaagcttcctccaagcaagagagacacataatagccaaactagaagagaaacggggccctcctctgcaaaaaaactgcccagatcctgagctctgccgccagagcttcagacgcttttgttatcaagaggtgtctggaccccaagaggcgctctcccagctccgacagctctgccgtcagtggttgcaacccgagctgcacaccaaggagcagattttggagcttctggtgatggagcagttcctgaccatcctgcccccggagatccaggctcgggtcaggcatcgatgtccaatgagcagcaaggagattgtgaccctcgtggaagattttcacagagcatccaagaaaccaaagcagtgggtggccgtttgtatgcaggggcaaaaggtgctcttggagaaaactggatctcagcttggagaacaggaactgccagactttcaaccgcagactcctaggagagatctcagggagagctctccagcagagccttcccaggcaggagcttatgaccggctgagcccccatcattgggagaaatccccactcctccaagaaccaacccccaaattggctgggacagaacttcttatagaaaagacagatccaaatatggccacagatgaacttccatgcaagctatggctgagtttcattgcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: