Login to display prices
Login to display prices
APIP-APAF1 interacting protein Gene View larger

APIP-APAF1 interacting protein Gene

PTXBC009077

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APIP-APAF1 interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APIP-APAF1 interacting protein Gene

Proteogenix catalog: PTXBC009077
Ncbi symbol: APIP
Product name: APIP-APAF1 interacting protein Gene
Size: 2ug
Accessions: BC009077
Gene id: 51074
Gene description: APAF1 interacting protein
Synonyms: APIP2; CGI-29; CGI29; MMRP19; hAPIP; methylthioribulose-1-phosphate dehydratase; MTRu-1-P dehydratase; APAF1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggctgtgatgctcgggagggagactgttgttcccggagatgcggcgcgcaggacaaggagcatccaagatacctgatcccagaactttgcaaacagttttaccatttaggctgggtcactgggactggaggaggaattagcttgaagcatggcgatgaaatctacattgctccttcaggagtgcaaaaggaacgaattcagcctgaagacatgtttgtttgtgatataaatgaaaaggacataagtggaccttcgccatcgaagaagctaaaaaaaagccagtgtactcctcttttcatgaatgcttacacaatgagaggagcaggtgcagtgattcatacccactctaaagctgctgtgatggccacacttctctttccaggacgggagtttaaaattacacatcaagagatgataaaaggaataaagaaatgtacttccggagggtattatagatatgatgatatgttagtggtacccattattgagaatacacctgaggagaaagacctcaaagatagaatggctcatgcaatgaatgaatacccagactcctgtgcagtactggtcagacgtcatggagtatatgtgtggggggaaacatgggagaaggccaaaaccatgtgtgagtgttatgactatttatttgatattgccgtatcaatgaagaaagtaggacttgatccttcacagctcccagttggagaaaatggaattgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: