LYPLA2-lysophospholipase II Gene View larger

LYPLA2-lysophospholipase II Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYPLA2-lysophospholipase II Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LYPLA2-lysophospholipase II Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017034
Product type: DNA & cDNA
Ncbi symbol: LYPLA2
Origin species: Human
Product name: LYPLA2-lysophospholipase II Gene
Size: 2ug
Accessions: BC017034
Gene id: 11313
Gene description: lysophospholipase II
Synonyms: APT-2; APT2; DJ886K2.4; acyl-protein thioesterase 2; LPL-II; lysoPLA II; testicular tissue protein Li 3; lysophospholipase II
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtggtaacaccatgtctgtgcccctgctcaccgatgctgccaccgtgtctggagctgagcgggaaacggccgcggttatttttttacatggacttggagacacagggcacagctgggctgacgccctctccaccatccggctccctcacgtcaagtacatctgtccccatgcgcctaggatccctgtgaccctcaacatgaagatggtgatgccctcctggtttgacctgatggggctgagtccagatgccccagaggacgaggctggcatcaagaaggcagcagagaacatcaaggccttgattgagcatgaaatgaagaacgggatccctgccaatcgaatcgtcctgggaggcttttcacagggcggggccctgtccctctacacggccctcacctgcccccaccctctggctggcatcgtggcgttgagctgctggctgcctctgcaccgggccttcccccaggcagctaatggcagtgccaaggacctggccatactccagtgccatggggagctggaccccatggtgcccgtacggtttggggccctgacggctgagaagctccggtctgttgtcacacctgccagggtccagttcaagacatacccgggtgtcatgcacagctcctgtcctcaggagatggcagctgtgaaggaatttcttgagaagctgctgcctcctgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LIM and SH3 protein 1
- Rap GTPase interactor
- protease, serine, 23
- PHD finger protein 10

Buy LYPLA2-lysophospholipase II Gene now

Add to cart