RADIL-Rap GTPase interactor Gene View larger

RADIL-Rap GTPase interactor Gene

PTXBC004919

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RADIL-Rap GTPase interactor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RADIL-Rap GTPase interactor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004919
Product type: DNA & cDNA
Ncbi symbol: RADIL
Origin species: Human
Product name: RADIL-Rap GTPase interactor Gene
Size: 2ug
Accessions: BC004919
Gene id: 55698
Gene description: Rap GTPase interactor
Synonyms: RASIP2; ras-associating and dilute domain-containing protein; Rap GTPase interactor; Ras association and DIL domains; Rap associating with DIL domain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcctagggtggggccagtcactgtggccaggatcccagcctcctgtgtccacagggcaggggactcagggctcaatctgctggcccctgggttcccacaccgttgggcggggcggcctggcgagggaggcagcttctcctgtggccattacgggcatcctctctcccctgcagaggatgttctggagtcctacgaaaaccccccacccatcgtcctgcccagcgacggcttccaggtggacttggaagccaactgcctggacgacagcatctaccagcacctgctctacgtccgccactttctgtggggtctgcggagcagagccagccccggcagccctggcaggcctggcagtggggcctcccagccagtgtgccccgagggtatgcaccacgtggtccttgacgggcacctggaggccccgagctgccccctggctcccagggaccctggcccagcagcccgggaagtggccccggagcgtactcttcccttgaggggggctccctgggcacaggccccccctggaaggcaacccggccgtgggggctcccaggctggccccccgcacacggactcgtcctgcttgctcacgcctcccagcactccacttggccctgagcctggggaccccgactggccagagtccggcggcccctgtggaaaagcgctcccagagaggcagaggaatggacccagcggcctccggggtgcagctccggaaggagactctgcagcccttgcggaggagtcccctccagccccgtccagccgcagctccagcaccgaggacttctgctacgtcttcacggtggagctggaacgaggcccctccgggctggggatgggcctgatcgacgggatgcacacgcacctgggcgcccccgggctctacatccagaccctgctcccgggcagccccgcagcggccgacgggcgcctgtcgctgggggaccgtatcctggaggtgaatggcagcagcctcctgggccttggctacctgagagctgtggacctgatccgtcatggcgggaagaagatgcggttcctggtcgcgaagtccgacgtggaaacagccaagaagatccatttccgcacgccccctctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protease, serine, 23
- PHD finger protein 10
- renin binding protein
- argininosuccinate lyase

Buy RADIL-Rap GTPase interactor Gene now

Add to cart