Login to display prices
Login to display prices
LASP1-LIM and SH3 protein 1 Gene View larger

LASP1-LIM and SH3 protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LASP1-LIM and SH3 protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LASP1-LIM and SH3 protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012460
Product type: DNA & cDNA
Ncbi symbol: LASP1
Origin species: Human
Product name: LASP1-LIM and SH3 protein 1 Gene
Size: 2ug
Accessions: BC012460
Gene id: 3927
Gene description: LIM and SH3 protein 1
Synonyms: Lasp-1; MLN50; LIM and SH3 domain protein 1; metastatic lymph node gene 50 protein; LIM and SH3 protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccccaactgcgcccggtgcggcaagatcgtgtatcccacggagaaggtgaactgtctggataagttctggcataaagcatgcttccattgcgagacctgcaagatgacactgaacatgaagaactacaagggctacgagaagaagccctactgcaacgcacactaccccaagcagtccttcaccatggtggcggacaccccggaaaaccttcgcctcaagcaacagagtaggctccagagtcaggtgcgctacaaggaggagtttgagaagaacaagggcaaaggtttcagcgtagtggcagacacgcccgagctccagagaatcaagaagacccaggaccagatcagtaatatcaaataccatgaggagtttgagaagagccgcatgggccctagcgggggcgagggcatggagccagagcgtcgggattcgcaggacggcagcagctaccggcggcccctggagcagcagcagcctcaccacatcccgaccagtgccccggtttaccagcagccccagcagcagccggtggcccagtcctatggtggctacaaggagcctgcagccccagtctccatacagcgcagcgccccaggtggtggcgggaagcggtaccgcgcggcgtatgactacagcgccgccgacgaggacgcggtctccttccaggacggggacaccatcgtcaacgtgcagcagatcgacgacggctggatgtacgggacggtggagcgcaccggcgacacggggatgctgccggccaactacgtggaggccatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rap GTPase interactor
- protease, serine, 23
- PHD finger protein 10
- renin binding protein