Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RCAN2-regulator of calcineurin 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCAN2-regulator of calcineurin 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038509 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCAN2 |
| Origin species: | Human |
| Product name: | RCAN2-regulator of calcineurin 2 Gene |
| Size: | 2ug |
| Accessions: | BC038509 |
| Gene id: | 10231 |
| Gene description: | regulator of calcineurin 2 |
| Synonyms: | CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4; calcipressin-2; Down syndrome candidate region 1-like 1; Down syndrome critical region gene 1-like 1; myocyte-enriched calcineurin-interacting protein 2; thyroid hormone-responsive (skin fibroblasts); thyroid hormone-responsive protein ZAKI-4; regulator of calcineurin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagcccctagcatggactgtgatgtttccactctggttgcctgtgtggtggatgtcgaggtctttaccaatcaggaggttaaggaaaaatttgagggactgtttcggacttatgatgactgtgtgacgttccagctatttaagagtttcagacgtgtccgtataaacttcagcaatcctaaatctgcagcccgagctaggatagagcttcatgaaacccaattcagagggaaaaaattaaagctctactttgcacaggttcagactccagagacagatggagacaaactgcacttggctccaccccagcctgccaaacagtttctcatctcgcccccttcctccccacctgttggctggcagcccatcaacgatgccacgccagtcctcaactatgacctcctctatgctgtggccaaactaggaccaggagagaagtatgagctccatgcagggactgagtccaccccaagtgtcgtcgtgcacgtgtgcgacagtgacatagaggaagaagaggacccaaagacttccccaaagccaaaaatcatccaaactcggcgtcctggcctgccaccctccgtgtccaactgggctgcctgctccttctcgataatagccgtctcctctttatcatgctttttccccctgttgtttgtcaaaaagaattgcctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcyclin binding protein - THAP domain containing 10 - RNA binding motif protein 7 - glycerol kinase 5 (putative) |