Login to display prices
Login to display prices
RCAN2-regulator of calcineurin 2 Gene View larger

RCAN2-regulator of calcineurin 2 Gene

PTXBC038509

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCAN2-regulator of calcineurin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RCAN2-regulator of calcineurin 2 Gene

Proteogenix catalog: PTXBC038509
Ncbi symbol: RCAN2
Product name: RCAN2-regulator of calcineurin 2 Gene
Size: 2ug
Accessions: BC038509
Gene id: 10231
Gene description: regulator of calcineurin 2
Synonyms: CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4; calcipressin-2; Down syndrome candidate region 1-like 1; Down syndrome critical region gene 1-like 1; myocyte-enriched calcineurin-interacting protein 2; thyroid hormone-responsive (skin fibroblasts); thyroid hormone-responsive protein ZAKI-4; regulator of calcineurin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagcccctagcatggactgtgatgtttccactctggttgcctgtgtggtggatgtcgaggtctttaccaatcaggaggttaaggaaaaatttgagggactgtttcggacttatgatgactgtgtgacgttccagctatttaagagtttcagacgtgtccgtataaacttcagcaatcctaaatctgcagcccgagctaggatagagcttcatgaaacccaattcagagggaaaaaattaaagctctactttgcacaggttcagactccagagacagatggagacaaactgcacttggctccaccccagcctgccaaacagtttctcatctcgcccccttcctccccacctgttggctggcagcccatcaacgatgccacgccagtcctcaactatgacctcctctatgctgtggccaaactaggaccaggagagaagtatgagctccatgcagggactgagtccaccccaagtgtcgtcgtgcacgtgtgcgacagtgacatagaggaagaagaggacccaaagacttccccaaagccaaaaatcatccaaactcggcgtcctggcctgccaccctccgtgtccaactgggctgcctgctccttctcgataatagccgtctcctctttatcatgctttttccccctgttgtttgtcaaaaagaattgcctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: