RCAN2-regulator of calcineurin 2 Gene View larger

RCAN2-regulator of calcineurin 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCAN2-regulator of calcineurin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RCAN2-regulator of calcineurin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038509
Product type: DNA & cDNA
Ncbi symbol: RCAN2
Origin species: Human
Product name: RCAN2-regulator of calcineurin 2 Gene
Size: 2ug
Accessions: BC038509
Gene id: 10231
Gene description: regulator of calcineurin 2
Synonyms: CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4; calcipressin-2; Down syndrome candidate region 1-like 1; Down syndrome critical region gene 1-like 1; myocyte-enriched calcineurin-interacting protein 2; thyroid hormone-responsive (skin fibroblasts); thyroid hormone-responsive protein ZAKI-4; regulator of calcineurin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagcccctagcatggactgtgatgtttccactctggttgcctgtgtggtggatgtcgaggtctttaccaatcaggaggttaaggaaaaatttgagggactgtttcggacttatgatgactgtgtgacgttccagctatttaagagtttcagacgtgtccgtataaacttcagcaatcctaaatctgcagcccgagctaggatagagcttcatgaaacccaattcagagggaaaaaattaaagctctactttgcacaggttcagactccagagacagatggagacaaactgcacttggctccaccccagcctgccaaacagtttctcatctcgcccccttcctccccacctgttggctggcagcccatcaacgatgccacgccagtcctcaactatgacctcctctatgctgtggccaaactaggaccaggagagaagtatgagctccatgcagggactgagtccaccccaagtgtcgtcgtgcacgtgtgcgacagtgacatagaggaagaagaggacccaaagacttccccaaagccaaaaatcatccaaactcggcgtcctggcctgccaccctccgtgtccaactgggctgcctgctccttctcgataatagccgtctcctctttatcatgctttttccccctgttgtttgtcaaaaagaattgcctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcyclin binding protein
- THAP domain containing 10
- RNA binding motif protein 7
- glycerol kinase 5 (putative)

Buy RCAN2-regulator of calcineurin 2 Gene now

Add to cart