ZNF672-zinc finger protein 672 Gene View larger

ZNF672-zinc finger protein 672 Gene

PTXBC008872

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF672-zinc finger protein 672 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF672-zinc finger protein 672 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008872
Product type: DNA & cDNA
Ncbi symbol: ZNF672
Origin species: Human
Product name: ZNF672-zinc finger protein 672 Gene
Size: 2ug
Accessions: BC008872
Gene id: 79894
Gene description: zinc finger protein 672
Synonyms: zinc finger protein 672
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgccacatctggggcagtggcagcggggaagccttactcgtgcagcgaatgtggcaagagcttctgctacagctcagtgctgctgcgacatgaacgagctcacggcggtgacggccgcttccgttgcctagaatgcggtgagcgctgtgcacgggctgctgacctccgagcgcacaggcgcacgcatgctggccagaccctctacatctgcagtgagtgcggacaaagcttccgccacagcggccgtcttgacctacacttgggcgcacaccggcagcgatgccgcacttgcccctgccgcacatgcggccggcgcttcccgcacctccccgcgctgctgctacaccggcgccgccagcatctgccagagcggccccttttgccatgctgtcctcgtataactcggattctctcctcaggtgtaggtgcagggagtcagggaacccttagactcccctgtgtgcaagagcccaggtgttggtgtgtccctttaatgctactgtgctctctggtgtttctgattttcctgcctttattctgtcttctcttgtcctatctcattccagcccacatcttctcctttcctgattacttttgttgtcctgcctcttcaggtaatggtcacagatttggctgtaggcacgttaccagccctgtggcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 114
- ring finger protein 141
- ring finger protein 125
- zinc finger protein 174

Buy ZNF672-zinc finger protein 672 Gene now

Add to cart