PACRGL-PARK2 co-regulated-like Gene View larger

PACRGL-PARK2 co-regulated-like Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PACRGL-PARK2 co-regulated-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PACRGL-PARK2 co-regulated-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023002
Product type: DNA & cDNA
Ncbi symbol: PACRGL
Origin species: Human
Product name: PACRGL-PARK2 co-regulated-like Gene
Size: 2ug
Accessions: BC023002
Gene id: 133015
Gene description: PARK2 co-regulated-like
Synonyms: C4orf28; PACRG-like protein; PARK2 co-regulated like; PARK2 coregulated like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaaatcagagggctctggaggtacacagttgaaaaacagagcaacaggtaactatgatcaaaggacatcatcaagcacacagttaaaacacaggaatgcagttcagggaagcaaatcctcattgtcaaccagttctccagagtctgcaagaaaacttcatcctagaccaagtgataaactgaaccctaaaacaattaatccgtttggtgaacagtcacgagtgccttctgcatttgcagctatttactctaaaggaggtattccttgcagattggtacatggttcagtaaaacacagattacagtgggaatgtcctcctgaaagtctttcatttgatccacttcttattactttagctgagggtctgagagagactaagcatccatacacttttgtgtcaaaggagggttttagagaattacttttggtcaaaggtgctcctgaaaaagctattcctttgctacctagactgattcctgtgctaaaggcagctctggtccattcggatgatgaagtgtttgaaagaggattgaatgctctagttcagctaagtgtcgttgttggtccttctctaaacgaccatctgaagcatctgcttacaagcgggagccttagcatcatcaaatctaaaattccaacatactgctccatatgctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 672
- ring finger protein 114
- ring finger protein 141
- ring finger protein 125

Buy PACRGL-PARK2 co-regulated-like Gene now

Add to cart