CLTA-clathrin, light chain (Lca) Gene View larger

CLTA-clathrin, light chain (Lca) Gene

PTXBC009201

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLTA-clathrin, light chain (Lca) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLTA-clathrin, light chain (Lca) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009201
Product type: DNA & cDNA
Ncbi symbol: CLTA
Origin species: Human
Product name: CLTA-clathrin, light chain (Lca) Gene
Size: 2ug
Accessions: BC009201
Gene id: 1211
Gene description: clathrin, light chain (Lca)
Synonyms: LCA; clathrin light chain A; clathrin, light polypeptide (Lca)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagctggatccgttcggcgcccctgccggcgcccctggcggtcccgcgctggggaacggagtggccggcgccggcgaagaagacccggctgcggccttcttggcgcagcaagagagcgagattgcgggcatcgagaacgacgaggccttcgccatcctggacggcggcgcccccgggccccagccgcacggcgagccgccggggggtccggatgctgttgatggagtaatgaatggtgaatactaccaggaaagtaatggtccaacagacagttatgcagctatttcacaagtggatcgattgcagtcagagcctgaaagtatccgtaaatggagagaagaacaaatggaacgcttggaagcccttgatgccaattctcggaagcaagaagcagagtggaaagaaaaggcaataaaggagctagaagaatggtatgcaagacaggacgagcagctacagaaaacaaaagcaaacaacagggcagcagaagaagcctttgtaaatgacattgacgagtcgtccccaggcactgagtgggaacgggtggcccggctgtgtgactttaaccccaagtctagcaagcaggccaaagatgtctcccgcatgcgctcagtcctcatctccctcaagcaggccccgctggtgcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of calcineurin 2
- calcyclin binding protein
- THAP domain containing 10
- RNA binding motif protein 7

Buy CLTA-clathrin, light chain (Lca) Gene now

Add to cart